ID: 1010047525

View in Genome Browser
Species Human (GRCh38)
Location 6:71463701-71463723
Sequence CAGAGACATGATTCTGTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010047523_1010047525 13 Left 1010047523 6:71463665-71463687 CCAATCATGAGGTTGAGGCATTC No data
Right 1010047525 6:71463701-71463723 CAGAGACATGATTCTGTCATTGG No data
1010047521_1010047525 21 Left 1010047521 6:71463657-71463679 CCTTGATTCCAATCATGAGGTTG No data
Right 1010047525 6:71463701-71463723 CAGAGACATGATTCTGTCATTGG No data
1010047519_1010047525 23 Left 1010047519 6:71463655-71463677 CCCCTTGATTCCAATCATGAGGT No data
Right 1010047525 6:71463701-71463723 CAGAGACATGATTCTGTCATTGG No data
1010047520_1010047525 22 Left 1010047520 6:71463656-71463678 CCCTTGATTCCAATCATGAGGTT No data
Right 1010047525 6:71463701-71463723 CAGAGACATGATTCTGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010047525 Original CRISPR CAGAGACATGATTCTGTCAT TGG Intergenic
No off target data available for this crispr