ID: 1010047547

View in Genome Browser
Species Human (GRCh38)
Location 6:71464114-71464136
Sequence CTTTCTCAAGTCAAGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010047547_1010047556 5 Left 1010047547 6:71464114-71464136 CCCTGTCCCTTGACTTGAGAAAG No data
Right 1010047556 6:71464142-71464164 CTGGTGACTGTTTGGAGTAATGG No data
1010047547_1010047557 15 Left 1010047547 6:71464114-71464136 CCCTGTCCCTTGACTTGAGAAAG No data
Right 1010047557 6:71464152-71464174 TTTGGAGTAATGGAACACAGTGG No data
1010047547_1010047555 -3 Left 1010047547 6:71464114-71464136 CCCTGTCCCTTGACTTGAGAAAG No data
Right 1010047555 6:71464134-71464156 AAGAGGGGCTGGTGACTGTTTGG No data
1010047547_1010047558 29 Left 1010047547 6:71464114-71464136 CCCTGTCCCTTGACTTGAGAAAG No data
Right 1010047558 6:71464166-71464188 ACACAGTGGAAGTGATGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010047547 Original CRISPR CTTTCTCAAGTCAAGGGACA GGG (reversed) Intergenic
No off target data available for this crispr