ID: 1010049426

View in Genome Browser
Species Human (GRCh38)
Location 6:71485269-71485291
Sequence GTTACATTCTGAGATGCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010049421_1010049426 4 Left 1010049421 6:71485242-71485264 CCTTTAAAGGCTATATTCCCAAA No data
Right 1010049426 6:71485269-71485291 GTTACATTCTGAGATGCTAGAGG No data
1010049419_1010049426 6 Left 1010049419 6:71485240-71485262 CCCCTTTAAAGGCTATATTCCCA No data
Right 1010049426 6:71485269-71485291 GTTACATTCTGAGATGCTAGAGG No data
1010049420_1010049426 5 Left 1010049420 6:71485241-71485263 CCCTTTAAAGGCTATATTCCCAA No data
Right 1010049426 6:71485269-71485291 GTTACATTCTGAGATGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010049426 Original CRISPR GTTACATTCTGAGATGCTAG AGG Intergenic
No off target data available for this crispr