ID: 1010050599

View in Genome Browser
Species Human (GRCh38)
Location 6:71499423-71499445
Sequence ATAAGTCATCTGGCCTTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010050595_1010050599 7 Left 1010050595 6:71499393-71499415 CCATAATTTTAAAAACTGGTGGA No data
Right 1010050599 6:71499423-71499445 ATAAGTCATCTGGCCTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010050599 Original CRISPR ATAAGTCATCTGGCCTTATT TGG Intergenic
No off target data available for this crispr