ID: 1010051083

View in Genome Browser
Species Human (GRCh38)
Location 6:71505134-71505156
Sequence CAGAACATGAGGGAGATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010051075_1010051083 -2 Left 1010051075 6:71505113-71505135 CCACCCGACACATCCCCTGGACA No data
Right 1010051083 6:71505134-71505156 CAGAACATGAGGGAGATCTCAGG No data
1010051077_1010051083 -6 Left 1010051077 6:71505117-71505139 CCGACACATCCCCTGGACAGAAC No data
Right 1010051083 6:71505134-71505156 CAGAACATGAGGGAGATCTCAGG No data
1010051076_1010051083 -5 Left 1010051076 6:71505116-71505138 CCCGACACATCCCCTGGACAGAA No data
Right 1010051083 6:71505134-71505156 CAGAACATGAGGGAGATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010051083 Original CRISPR CAGAACATGAGGGAGATCTC AGG Intergenic
No off target data available for this crispr