ID: 1010054391

View in Genome Browser
Species Human (GRCh38)
Location 6:71547667-71547689
Sequence CTCAATCATCACAACAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010054391_1010054393 0 Left 1010054391 6:71547667-71547689 CCAAAATTGTTGTGATGATTGAG No data
Right 1010054393 6:71547690-71547712 GTAGATATGTATGTCCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010054391 Original CRISPR CTCAATCATCACAACAATTT TGG (reversed) Intergenic
No off target data available for this crispr