ID: 1010055150

View in Genome Browser
Species Human (GRCh38)
Location 6:71556378-71556400
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010055150_1010055154 -6 Left 1010055150 6:71556378-71556400 CCACACTGAAGCACTGCCTAGTG No data
Right 1010055154 6:71556395-71556417 CTAGTGGAGCTGTGAGACGAGGG No data
1010055150_1010055153 -7 Left 1010055150 6:71556378-71556400 CCACACTGAAGCACTGCCTAGTG No data
Right 1010055153 6:71556394-71556416 CCTAGTGGAGCTGTGAGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010055150 Original CRISPR CACTAGGCAGTGCTTCAGTG TGG (reversed) Intergenic