ID: 1010055154

View in Genome Browser
Species Human (GRCh38)
Location 6:71556395-71556417
Sequence CTAGTGGAGCTGTGAGACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010055149_1010055154 -5 Left 1010055149 6:71556377-71556399 CCCACACTGAAGCACTGCCTAGT No data
Right 1010055154 6:71556395-71556417 CTAGTGGAGCTGTGAGACGAGGG No data
1010055150_1010055154 -6 Left 1010055150 6:71556378-71556400 CCACACTGAAGCACTGCCTAGTG No data
Right 1010055154 6:71556395-71556417 CTAGTGGAGCTGTGAGACGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010055154 Original CRISPR CTAGTGGAGCTGTGAGACGA GGG Intergenic