ID: 1010055154 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:71556395-71556417 |
Sequence | CTAGTGGAGCTGTGAGACGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1010055149_1010055154 | -5 | Left | 1010055149 | 6:71556377-71556399 | CCCACACTGAAGCACTGCCTAGT | No data | ||
Right | 1010055154 | 6:71556395-71556417 | CTAGTGGAGCTGTGAGACGAGGG | No data | ||||
1010055150_1010055154 | -6 | Left | 1010055150 | 6:71556378-71556400 | CCACACTGAAGCACTGCCTAGTG | No data | ||
Right | 1010055154 | 6:71556395-71556417 | CTAGTGGAGCTGTGAGACGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1010055154 | Original CRISPR | CTAGTGGAGCTGTGAGACGA GGG | Intergenic | ||