ID: 1010055975 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:71564029-71564051 |
| Sequence | AAATAGCCATAGACTGAGCA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1010055974_1010055975 | -10 | Left | 1010055974 | 6:71564016-71564038 | CCTCAGTTGTAGGAAATAGCCAT | No data | ||
| Right | 1010055975 | 6:71564029-71564051 | AAATAGCCATAGACTGAGCACGG | No data | ||||
| 1010055973_1010055975 | -5 | Left | 1010055973 | 6:71564011-71564033 | CCTTTCCTCAGTTGTAGGAAATA | No data | ||
| Right | 1010055975 | 6:71564029-71564051 | AAATAGCCATAGACTGAGCACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1010055975 | Original CRISPR | AAATAGCCATAGACTGAGCA CGG | Intergenic | ||
| No off target data available for this crispr | |||||