ID: 1010055975

View in Genome Browser
Species Human (GRCh38)
Location 6:71564029-71564051
Sequence AAATAGCCATAGACTGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010055974_1010055975 -10 Left 1010055974 6:71564016-71564038 CCTCAGTTGTAGGAAATAGCCAT No data
Right 1010055975 6:71564029-71564051 AAATAGCCATAGACTGAGCACGG No data
1010055973_1010055975 -5 Left 1010055973 6:71564011-71564033 CCTTTCCTCAGTTGTAGGAAATA No data
Right 1010055975 6:71564029-71564051 AAATAGCCATAGACTGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010055975 Original CRISPR AAATAGCCATAGACTGAGCA CGG Intergenic
No off target data available for this crispr