ID: 1010057110

View in Genome Browser
Species Human (GRCh38)
Location 6:71579321-71579343
Sequence GAGCAGTTCTTACCAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010057110_1010057115 16 Left 1010057110 6:71579321-71579343 CCAGCTTCTGGTAAGAACTGCTC No data
Right 1010057115 6:71579360-71579382 GCATCTTTGGGATTTCTGTATGG No data
1010057110_1010057111 -6 Left 1010057110 6:71579321-71579343 CCAGCTTCTGGTAAGAACTGCTC No data
Right 1010057111 6:71579338-71579360 CTGCTCAAGTCTCCTTTTAGTGG No data
1010057110_1010057113 4 Left 1010057110 6:71579321-71579343 CCAGCTTCTGGTAAGAACTGCTC No data
Right 1010057113 6:71579348-71579370 CTCCTTTTAGTGGCATCTTTGGG No data
1010057110_1010057117 30 Left 1010057110 6:71579321-71579343 CCAGCTTCTGGTAAGAACTGCTC No data
Right 1010057117 6:71579374-71579396 TCTGTATGGCTGAGACTCAAGGG No data
1010057110_1010057112 3 Left 1010057110 6:71579321-71579343 CCAGCTTCTGGTAAGAACTGCTC No data
Right 1010057112 6:71579347-71579369 TCTCCTTTTAGTGGCATCTTTGG No data
1010057110_1010057116 29 Left 1010057110 6:71579321-71579343 CCAGCTTCTGGTAAGAACTGCTC No data
Right 1010057116 6:71579373-71579395 TTCTGTATGGCTGAGACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010057110 Original CRISPR GAGCAGTTCTTACCAGAAGC TGG (reversed) Intergenic