ID: 1010062272

View in Genome Browser
Species Human (GRCh38)
Location 6:71636478-71636500
Sequence AGGGAGAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010062272_1010062277 30 Left 1010062272 6:71636478-71636500 CCCACAATCACTGTGCTCTCCCT No data
Right 1010062277 6:71636531-71636553 CACACAGCTGCTCCTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010062272 Original CRISPR AGGGAGAGCACAGTGATTGT GGG (reversed) Intergenic