ID: 1010062351

View in Genome Browser
Species Human (GRCh38)
Location 6:71637726-71637748
Sequence TTGAATAAGAGTGATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010062351_1010062353 11 Left 1010062351 6:71637726-71637748 CCATTCTCATCACTCTTATTCAA No data
Right 1010062353 6:71637760-71637782 AAGACTTAGCAAGAGCAATTAGG No data
1010062351_1010062354 30 Left 1010062351 6:71637726-71637748 CCATTCTCATCACTCTTATTCAA No data
Right 1010062354 6:71637779-71637801 TAGGCAAGATTAAGAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010062351 Original CRISPR TTGAATAAGAGTGATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr