ID: 1010063757

View in Genome Browser
Species Human (GRCh38)
Location 6:71655979-71656001
Sequence CATTACATTCAGAAATTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010063747_1010063757 29 Left 1010063747 6:71655927-71655949 CCCCATTTGCCCTCTACCTAGGT No data
Right 1010063757 6:71655979-71656001 CATTACATTCAGAAATTGGTGGG No data
1010063752_1010063757 13 Left 1010063752 6:71655943-71655965 CCTAGGTTTTTCTTCTTAGACTG No data
Right 1010063757 6:71655979-71656001 CATTACATTCAGAAATTGGTGGG No data
1010063748_1010063757 28 Left 1010063748 6:71655928-71655950 CCCATTTGCCCTCTACCTAGGTT No data
Right 1010063757 6:71655979-71656001 CATTACATTCAGAAATTGGTGGG No data
1010063749_1010063757 27 Left 1010063749 6:71655929-71655951 CCATTTGCCCTCTACCTAGGTTT No data
Right 1010063757 6:71655979-71656001 CATTACATTCAGAAATTGGTGGG No data
1010063750_1010063757 20 Left 1010063750 6:71655936-71655958 CCCTCTACCTAGGTTTTTCTTCT No data
Right 1010063757 6:71655979-71656001 CATTACATTCAGAAATTGGTGGG No data
1010063751_1010063757 19 Left 1010063751 6:71655937-71655959 CCTCTACCTAGGTTTTTCTTCTT No data
Right 1010063757 6:71655979-71656001 CATTACATTCAGAAATTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010063757 Original CRISPR CATTACATTCAGAAATTGGT GGG Intergenic
No off target data available for this crispr