ID: 1010064972

View in Genome Browser
Species Human (GRCh38)
Location 6:71672004-71672026
Sequence CGGGGTCACATCTGGCTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010064972_1010064981 26 Left 1010064972 6:71672004-71672026 CCAATTAGCCAGATGTGACCCCG No data
Right 1010064981 6:71672053-71672075 ATATAACCCTTAGCTTTTGCTGG No data
1010064972_1010064978 -3 Left 1010064972 6:71672004-71672026 CCAATTAGCCAGATGTGACCCCG No data
Right 1010064978 6:71672024-71672046 CCGTTGATGTCCTAGAGGAGAGG No data
1010064972_1010064979 2 Left 1010064972 6:71672004-71672026 CCAATTAGCCAGATGTGACCCCG No data
Right 1010064979 6:71672029-71672051 GATGTCCTAGAGGAGAGGCATGG No data
1010064972_1010064982 29 Left 1010064972 6:71672004-71672026 CCAATTAGCCAGATGTGACCCCG No data
Right 1010064982 6:71672056-71672078 TAACCCTTAGCTTTTGCTGGTGG No data
1010064972_1010064974 -8 Left 1010064972 6:71672004-71672026 CCAATTAGCCAGATGTGACCCCG No data
Right 1010064974 6:71672019-71672041 TGACCCCGTTGATGTCCTAGAGG No data
1010064972_1010064983 30 Left 1010064972 6:71672004-71672026 CCAATTAGCCAGATGTGACCCCG No data
Right 1010064983 6:71672057-71672079 AACCCTTAGCTTTTGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010064972 Original CRISPR CGGGGTCACATCTGGCTAAT TGG (reversed) Intergenic