ID: 1010064974

View in Genome Browser
Species Human (GRCh38)
Location 6:71672019-71672041
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010064972_1010064974 -8 Left 1010064972 6:71672004-71672026 CCAATTAGCCAGATGTGACCCCG No data
Right 1010064974 6:71672019-71672041 TGACCCCGTTGATGTCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010064974 Original CRISPR TGACCCCGTTGATGTCCTAG AGG Intergenic