ID: 1010064977

View in Genome Browser
Species Human (GRCh38)
Location 6:71672024-71672046
Sequence CCTCTCCTCTAGGACATCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010064977_1010064983 10 Left 1010064977 6:71672024-71672046 CCGTTGATGTCCTAGAGGAGAGG No data
Right 1010064983 6:71672057-71672079 AACCCTTAGCTTTTGCTGGTGGG No data
1010064977_1010064982 9 Left 1010064977 6:71672024-71672046 CCGTTGATGTCCTAGAGGAGAGG No data
Right 1010064982 6:71672056-71672078 TAACCCTTAGCTTTTGCTGGTGG No data
1010064977_1010064986 20 Left 1010064977 6:71672024-71672046 CCGTTGATGTCCTAGAGGAGAGG No data
Right 1010064986 6:71672067-71672089 TTTTGCTGGTGGGTTCTCAAAGG No data
1010064977_1010064981 6 Left 1010064977 6:71672024-71672046 CCGTTGATGTCCTAGAGGAGAGG No data
Right 1010064981 6:71672053-71672075 ATATAACCCTTAGCTTTTGCTGG No data
1010064977_1010064987 21 Left 1010064977 6:71672024-71672046 CCGTTGATGTCCTAGAGGAGAGG No data
Right 1010064987 6:71672068-71672090 TTTGCTGGTGGGTTCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010064977 Original CRISPR CCTCTCCTCTAGGACATCAA CGG (reversed) Intergenic
No off target data available for this crispr