ID: 1010064979

View in Genome Browser
Species Human (GRCh38)
Location 6:71672029-71672051
Sequence GATGTCCTAGAGGAGAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010064973_1010064979 -6 Left 1010064973 6:71672012-71672034 CCAGATGTGACCCCGTTGATGTC No data
Right 1010064979 6:71672029-71672051 GATGTCCTAGAGGAGAGGCATGG No data
1010064972_1010064979 2 Left 1010064972 6:71672004-71672026 CCAATTAGCCAGATGTGACCCCG No data
Right 1010064979 6:71672029-71672051 GATGTCCTAGAGGAGAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010064979 Original CRISPR GATGTCCTAGAGGAGAGGCA TGG Intergenic