ID: 1010064979 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:71672029-71672051 |
| Sequence | GATGTCCTAGAGGAGAGGCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1010064973_1010064979 | -6 | Left | 1010064973 | 6:71672012-71672034 | CCAGATGTGACCCCGTTGATGTC | No data | ||
| Right | 1010064979 | 6:71672029-71672051 | GATGTCCTAGAGGAGAGGCATGG | No data | ||||
| 1010064972_1010064979 | 2 | Left | 1010064972 | 6:71672004-71672026 | CCAATTAGCCAGATGTGACCCCG | No data | ||
| Right | 1010064979 | 6:71672029-71672051 | GATGTCCTAGAGGAGAGGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1010064979 | Original CRISPR | GATGTCCTAGAGGAGAGGCA TGG | Intergenic | ||