ID: 1010064981

View in Genome Browser
Species Human (GRCh38)
Location 6:71672053-71672075
Sequence ATATAACCCTTAGCTTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010064975_1010064981 8 Left 1010064975 6:71672022-71672044 CCCCGTTGATGTCCTAGAGGAGA No data
Right 1010064981 6:71672053-71672075 ATATAACCCTTAGCTTTTGCTGG No data
1010064973_1010064981 18 Left 1010064973 6:71672012-71672034 CCAGATGTGACCCCGTTGATGTC No data
Right 1010064981 6:71672053-71672075 ATATAACCCTTAGCTTTTGCTGG No data
1010064977_1010064981 6 Left 1010064977 6:71672024-71672046 CCGTTGATGTCCTAGAGGAGAGG No data
Right 1010064981 6:71672053-71672075 ATATAACCCTTAGCTTTTGCTGG No data
1010064972_1010064981 26 Left 1010064972 6:71672004-71672026 CCAATTAGCCAGATGTGACCCCG No data
Right 1010064981 6:71672053-71672075 ATATAACCCTTAGCTTTTGCTGG No data
1010064980_1010064981 -4 Left 1010064980 6:71672034-71672056 CCTAGAGGAGAGGCATGGTATAT No data
Right 1010064981 6:71672053-71672075 ATATAACCCTTAGCTTTTGCTGG No data
1010064976_1010064981 7 Left 1010064976 6:71672023-71672045 CCCGTTGATGTCCTAGAGGAGAG No data
Right 1010064981 6:71672053-71672075 ATATAACCCTTAGCTTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010064981 Original CRISPR ATATAACCCTTAGCTTTTGC TGG Intergenic