ID: 1010068956

View in Genome Browser
Species Human (GRCh38)
Location 6:71720614-71720636
Sequence ATTTGTGTATTTGCACCTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010068955_1010068956 11 Left 1010068955 6:71720580-71720602 CCATCAGAAGAAAAACACTGGGA No data
Right 1010068956 6:71720614-71720636 ATTTGTGTATTTGCACCTAACGG No data
1010068952_1010068956 18 Left 1010068952 6:71720573-71720595 CCATCTTCCATCAGAAGAAAAAC No data
Right 1010068956 6:71720614-71720636 ATTTGTGTATTTGCACCTAACGG No data
1010068950_1010068956 22 Left 1010068950 6:71720569-71720591 CCTCCCATCTTCCATCAGAAGAA No data
Right 1010068956 6:71720614-71720636 ATTTGTGTATTTGCACCTAACGG No data
1010068951_1010068956 19 Left 1010068951 6:71720572-71720594 CCCATCTTCCATCAGAAGAAAAA No data
Right 1010068956 6:71720614-71720636 ATTTGTGTATTTGCACCTAACGG No data
1010068949_1010068956 23 Left 1010068949 6:71720568-71720590 CCCTCCCATCTTCCATCAGAAGA No data
Right 1010068956 6:71720614-71720636 ATTTGTGTATTTGCACCTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010068956 Original CRISPR ATTTGTGTATTTGCACCTAA CGG Intergenic
No off target data available for this crispr