ID: 1010073603

View in Genome Browser
Species Human (GRCh38)
Location 6:71773390-71773412
Sequence TTGGAGAAGCAGAAGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010073603_1010073608 -4 Left 1010073603 6:71773390-71773412 CCTTTCCCCTTCTGCTTCTCCAA No data
Right 1010073608 6:71773409-71773431 CCAAACTTTCCATAACTTTCTGG No data
1010073603_1010073610 24 Left 1010073603 6:71773390-71773412 CCTTTCCCCTTCTGCTTCTCCAA No data
Right 1010073610 6:71773437-71773459 TCCCCATATTTGTAAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010073603 Original CRISPR TTGGAGAAGCAGAAGGGGAA AGG (reversed) Intergenic
No off target data available for this crispr