ID: 1010075661

View in Genome Browser
Species Human (GRCh38)
Location 6:71794203-71794225
Sequence AGGACTGGCCAGGATGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010075661_1010075665 3 Left 1010075661 6:71794203-71794225 CCATCTACATCCTGGCCAGTCCT No data
Right 1010075665 6:71794229-71794251 AAGTTTCTTCCCAAATATTTTGG No data
1010075661_1010075668 12 Left 1010075661 6:71794203-71794225 CCATCTACATCCTGGCCAGTCCT No data
Right 1010075668 6:71794238-71794260 CCCAAATATTTTGGATGAAAGGG No data
1010075661_1010075666 11 Left 1010075661 6:71794203-71794225 CCATCTACATCCTGGCCAGTCCT No data
Right 1010075666 6:71794237-71794259 TCCCAAATATTTTGGATGAAAGG No data
1010075661_1010075670 15 Left 1010075661 6:71794203-71794225 CCATCTACATCCTGGCCAGTCCT No data
Right 1010075670 6:71794241-71794263 AAATATTTTGGATGAAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010075661 Original CRISPR AGGACTGGCCAGGATGTAGA TGG (reversed) Intergenic
No off target data available for this crispr