ID: 1010082361

View in Genome Browser
Species Human (GRCh38)
Location 6:71878745-71878767
Sequence TTTCAAAGTACCGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010082361_1010082369 3 Left 1010082361 6:71878745-71878767 CCTGTAATCCCGGTACTTTGAAA No data
Right 1010082369 6:71878771-71878793 CAAGGTGGAAGGATCCCCTGAGG No data
1010082361_1010082367 -8 Left 1010082361 6:71878745-71878767 CCTGTAATCCCGGTACTTTGAAA No data
Right 1010082367 6:71878760-71878782 CTTTGAAAGGCCAAGGTGGAAGG 0: 6
1: 208
2: 3703
3: 32368
4: 89859

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010082361 Original CRISPR TTTCAAAGTACCGGGATTAC AGG (reversed) Intergenic
No off target data available for this crispr