ID: 1010082367

View in Genome Browser
Species Human (GRCh38)
Location 6:71878760-71878782
Sequence CTTTGAAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126144
Summary {0: 6, 1: 208, 2: 3703, 3: 32368, 4: 89859}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010082361_1010082367 -8 Left 1010082361 6:71878745-71878767 CCTGTAATCCCGGTACTTTGAAA No data
Right 1010082367 6:71878760-71878782 CTTTGAAAGGCCAAGGTGGAAGG 0: 6
1: 208
2: 3703
3: 32368
4: 89859
1010082360_1010082367 -7 Left 1010082360 6:71878744-71878766 CCCTGTAATCCCGGTACTTTGAA No data
Right 1010082367 6:71878760-71878782 CTTTGAAAGGCCAAGGTGGAAGG 0: 6
1: 208
2: 3703
3: 32368
4: 89859

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010082367 Original CRISPR CTTTGAAAGGCCAAGGTGGA AGG Intergenic
Too many off-targets to display for this crispr