ID: 1010082929

View in Genome Browser
Species Human (GRCh38)
Location 6:71885738-71885760
Sequence GTAGTTCAGAGTATCTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010082929_1010082930 15 Left 1010082929 6:71885738-71885760 CCTACAGAGATACTCTGAACTAC No data
Right 1010082930 6:71885776-71885798 ATGATAGCGAACATCATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010082929 Original CRISPR GTAGTTCAGAGTATCTCTGT AGG (reversed) Intergenic
No off target data available for this crispr