ID: 1010083093

View in Genome Browser
Species Human (GRCh38)
Location 6:71886696-71886718
Sequence AGGCGCGGCGGGAGAGGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 812
Summary {0: 1, 1: 1, 2: 2, 3: 41, 4: 767}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010083093_1010083103 4 Left 1010083093 6:71886696-71886718 CCCTCGCCTCTCCCGCCGCGCCT 0: 1
1: 1
2: 2
3: 41
4: 767
Right 1010083103 6:71886723-71886745 CTGCCCGCCCCCGCCGGCCGAGG 0: 1
1: 1
2: 5
3: 50
4: 532
1010083093_1010083113 16 Left 1010083093 6:71886696-71886718 CCCTCGCCTCTCCCGCCGCGCCT 0: 1
1: 1
2: 2
3: 41
4: 767
Right 1010083113 6:71886735-71886757 GCCGGCCGAGGCTGGGCTGCGGG 0: 1
1: 0
2: 4
3: 49
4: 431
1010083093_1010083118 26 Left 1010083093 6:71886696-71886718 CCCTCGCCTCTCCCGCCGCGCCT 0: 1
1: 1
2: 2
3: 41
4: 767
Right 1010083118 6:71886745-71886767 GCTGGGCTGCGGGAGGCGGCCGG 0: 1
1: 0
2: 6
3: 96
4: 736
1010083093_1010083107 9 Left 1010083093 6:71886696-71886718 CCCTCGCCTCTCCCGCCGCGCCT 0: 1
1: 1
2: 2
3: 41
4: 767
Right 1010083107 6:71886728-71886750 CGCCCCCGCCGGCCGAGGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 158
1010083093_1010083115 19 Left 1010083093 6:71886696-71886718 CCCTCGCCTCTCCCGCCGCGCCT 0: 1
1: 1
2: 2
3: 41
4: 767
Right 1010083115 6:71886738-71886760 GGCCGAGGCTGGGCTGCGGGAGG 0: 1
1: 0
2: 6
3: 111
4: 771
1010083093_1010083120 30 Left 1010083093 6:71886696-71886718 CCCTCGCCTCTCCCGCCGCGCCT 0: 1
1: 1
2: 2
3: 41
4: 767
Right 1010083120 6:71886749-71886771 GGCTGCGGGAGGCGGCCGGGCGG 0: 1
1: 0
2: 5
3: 97
4: 812
1010083093_1010083106 8 Left 1010083093 6:71886696-71886718 CCCTCGCCTCTCCCGCCGCGCCT 0: 1
1: 1
2: 2
3: 41
4: 767
Right 1010083106 6:71886727-71886749 CCGCCCCCGCCGGCCGAGGCTGG 0: 1
1: 0
2: 2
3: 38
4: 363
1010083093_1010083119 27 Left 1010083093 6:71886696-71886718 CCCTCGCCTCTCCCGCCGCGCCT 0: 1
1: 1
2: 2
3: 41
4: 767
Right 1010083119 6:71886746-71886768 CTGGGCTGCGGGAGGCGGCCGGG 0: 1
1: 0
2: 2
3: 79
4: 592
1010083093_1010083100 -2 Left 1010083093 6:71886696-71886718 CCCTCGCCTCTCCCGCCGCGCCT 0: 1
1: 1
2: 2
3: 41
4: 767
Right 1010083100 6:71886717-71886739 CTCCGCCTGCCCGCCCCCGCCGG 0: 1
1: 0
2: 3
3: 67
4: 761
1010083093_1010083117 22 Left 1010083093 6:71886696-71886718 CCCTCGCCTCTCCCGCCGCGCCT 0: 1
1: 1
2: 2
3: 41
4: 767
Right 1010083117 6:71886741-71886763 CGAGGCTGGGCTGCGGGAGGCGG 0: 1
1: 0
2: 4
3: 93
4: 803
1010083093_1010083112 15 Left 1010083093 6:71886696-71886718 CCCTCGCCTCTCCCGCCGCGCCT 0: 1
1: 1
2: 2
3: 41
4: 767
Right 1010083112 6:71886734-71886756 CGCCGGCCGAGGCTGGGCTGCGG 0: 1
1: 0
2: 2
3: 28
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010083093 Original CRISPR AGGCGCGGCGGGAGAGGCGA GGG (reversed) Intronic
900227662 1:1540503-1540525 AGGCGCGGGGGGGGGGGCGCCGG + Intergenic
900370967 1:2331983-2332005 CGCAGCGGCGGGAGAGGCGCAGG - Intronic
900411172 1:2513367-2513389 AGGCTCGGCGTGTGAGGGGAGGG + Intronic
900662006 1:3789476-3789498 AGGAGCAGCAGCAGAGGCGAAGG + Intronic
900686914 1:3954544-3954566 AGGGGCGGGAGGAGAGGCGGTGG - Intergenic
901074942 1:6548246-6548268 AGGTGAGGCGGGAGAATCGATGG - Intronic
901357458 1:8663761-8663783 AGGTGAGGCTGGAGAGGTGAAGG - Intronic
901443470 1:9293129-9293151 AGGCGCGGGGGGCCGGGCGAGGG + Intronic
902032098 1:13430546-13430568 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
902044362 1:13513802-13513824 GGGCGGGGAGGGAGGGGCGAGGG + Exonic
902409955 1:16206742-16206764 AGCCGCTGAGCGAGAGGCGAGGG - Intronic
903034607 1:20485855-20485877 AGGGGCGGAGGGGGAGGGGAGGG + Exonic
903363119 1:22789508-22789530 GGGCACAGCGGGAGAGGGGAGGG + Intronic
903624569 1:24721515-24721537 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
904238913 1:29131448-29131470 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
904322721 1:29707569-29707591 AGGGGAGGCAGGAGAGGAGAGGG + Intergenic
905267383 1:36764171-36764193 TGCCGAGGCGGGAGAGGAGATGG + Intergenic
906518371 1:46452847-46452869 AGGCGGGGAGGGAGAGGAGCAGG - Intergenic
906876110 1:49541323-49541345 AGGTGTGGAGGGAGAGGCGTGGG + Intronic
907170618 1:52459920-52459942 AGGGGAGGGGGGAGAGGAGAGGG + Intronic
908082777 1:60598531-60598553 AGGGGCGGGGGGAGAAGGGAGGG + Intergenic
908299890 1:62753421-62753443 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
909335207 1:74465270-74465292 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
909608764 1:77532094-77532116 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
910334301 1:86110549-86110571 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
910478856 1:87636597-87636619 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
910676624 1:89821829-89821851 AGGCGCGGGGGGCGGGGCGCGGG - Intronic
910693171 1:89984988-89985010 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
910892214 1:92029981-92030003 AGGCGCGCGTCGAGAGGCGACGG + Exonic
911001420 1:93170258-93170280 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
911458068 1:98153113-98153135 TGGGGTGGGGGGAGAGGCGAGGG - Intergenic
911527544 1:99004758-99004780 GGGCGCGGCGGCGGAGGCGGCGG + Exonic
911626754 1:100132932-100132954 AGGCGGGGAGGGAGAAACGAGGG + Exonic
911807989 1:102235145-102235167 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
911853909 1:102853767-102853789 AGGTGTGGCGGGAGAGACGCAGG + Intergenic
912538797 1:110396708-110396730 AGGCGTGGAGGGAGAGGCAGGGG - Intergenic
912959500 1:114182766-114182788 TGGGGTGGCGGGAGAGGGGAGGG - Intergenic
913020077 1:114780548-114780570 AGACGCTGCTGGAGAGGCTACGG - Exonic
914703872 1:150155937-150155959 AGGCACGCCAGGAGAGGAGAGGG - Intronic
915837349 1:159188318-159188340 AGGCGAGGGGCGAGAGGAGAGGG - Intronic
915937053 1:160095806-160095828 TGGCGCAGCTGGAGAGGGGAGGG - Intronic
916107725 1:161443113-161443135 GGGCGCGGAGGGAGAGCGGAGGG - Intergenic
916109309 1:161450486-161450508 GGGCGCGGAGGGAGAGCGGAGGG - Intergenic
916110896 1:161457917-161457939 GGGCGCGGAGGGAGAGCGGAGGG - Intergenic
916112482 1:161465277-161465299 GGGCGCGGAGGGAGAGCGGAGGG - Intergenic
916114066 1:161472694-161472716 GGGCGCGGAGGGAGAGCGGAGGG - Intergenic
916830986 1:168490983-168491005 AGGGTCGGCGGGAGTGGGGAGGG - Intergenic
917348906 1:174056743-174056765 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
917406257 1:174711208-174711230 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
918480648 1:184974033-184974055 CGAGGCGGCGGGAGCGGCGAAGG + Intronic
918793139 1:188857619-188857641 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
918943014 1:191026365-191026387 AGGCGTGGAGGGAGAGGTGTGGG - Intergenic
918951971 1:191151415-191151437 AGGTGTGGAGGGAGAGGCGCTGG + Intergenic
918993856 1:191731804-191731826 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
919049826 1:192499431-192499453 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
919250807 1:195054311-195054333 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
919297806 1:195723259-195723281 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
919630925 1:199959663-199959685 AGGGGTGGAGGGAGAGGCGCGGG + Intergenic
920180474 1:204129294-204129316 AGGGGCGGGCGGAGAGGGGAGGG - Intergenic
920604900 1:207371767-207371789 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
920886865 1:209938110-209938132 GGGCGCCGCGGGCGGGGCGAGGG - Intergenic
921096251 1:211889538-211889560 AGGGGCGGAGGGAGAGGCGCGGG + Intergenic
923081607 1:230662020-230662042 AGGAGAGGAGGGAGAGGAGAGGG - Intronic
923130346 1:231069499-231069521 AGGTGCAGCTGGAGAGGCCATGG - Intergenic
923172633 1:231431144-231431166 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
923193486 1:231642276-231642298 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
923353144 1:233129113-233129135 AGGTGTGGAGGGAGAGGCGTGGG + Intronic
924280361 1:242430886-242430908 AGGCGCTGCAGGACAGGCGTGGG - Intronic
924289749 1:242524810-242524832 GGGCGCGGCGGGAGGGGCGGCGG - Intergenic
1063131677 10:3183420-3183442 AGGAGCGGGGGGAGAGGAGGAGG - Intergenic
1063602315 10:7493546-7493568 AGGGGCTGGGGGAGAGGAGACGG + Intergenic
1064460996 10:15534973-15534995 AGGCACGGGGGGAGAGGCGCAGG + Intronic
1064694399 10:17950914-17950936 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
1065024379 10:21526593-21526615 AGGCGCGGCGGGGGCGTCGAGGG - Intergenic
1065590280 10:27256469-27256491 AGGCCTGGAGGGAGAGGCGCGGG + Intergenic
1065752204 10:28897147-28897169 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1065895859 10:30162844-30162866 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1066080711 10:31928538-31928560 AGGCGCGGCGGCGGCGGCGGCGG - Intronic
1066234002 10:33468023-33468045 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1066235506 10:33480835-33480857 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
1067474455 10:46556687-46556709 CGGGGCGGCGGGAGGGGCGGCGG + Intergenic
1068211297 10:53924172-53924194 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
1068460337 10:57321510-57321532 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1068461646 10:57337077-57337099 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1068821004 10:61377241-61377263 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
1069037894 10:63664608-63664630 AGGGGCGGGGGGAGGGGCGGGGG + Intergenic
1069090851 10:64197142-64197164 AGGTGGGGAGGGAGAGGCGCGGG - Intergenic
1069660496 10:70120542-70120564 AGGCTCGGCTGGAGTGGAGATGG - Exonic
1069988638 10:72300598-72300620 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1070564103 10:77590558-77590580 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1070877306 10:79826112-79826134 AGGCCCGGCGGGCAAGGCGGCGG + Intergenic
1070942596 10:80359860-80359882 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1071055668 10:81505816-81505838 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1071291864 10:84194624-84194646 AGCCGCGGCGGGAGGGGGCACGG - Intergenic
1071643803 10:87342156-87342178 AGGCCCGGCGGGCAAGGCGGCGG + Intergenic
1072278461 10:93845178-93845200 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1072677352 10:97477925-97477947 AGGCTCTGGGGGAGAGGAGAAGG + Exonic
1073532477 10:104245164-104245186 AGGTGTGGAGGGAGAGGCGTGGG + Intronic
1073636495 10:105204065-105204087 AAGCACGGTGGGAGAGGCGAGGG + Intronic
1074098090 10:110331441-110331463 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
1074316971 10:112369777-112369799 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1074317108 10:112370301-112370323 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
1074996386 10:118760518-118760540 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1075006703 10:118835852-118835874 AGGTGGGGAGGGAGAGGAGATGG - Intergenic
1075307595 10:121382152-121382174 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
1076869367 10:133185907-133185929 AGGGGCGGGAGGAGAGGGGAGGG + Intronic
1076871490 10:133197155-133197177 AAGCGCGGCGGAGGAGGCGGCGG - Intronic
1077514188 11:2992000-2992022 AGGCGCGCCGGGAGTTGGGAGGG + Intronic
1077764554 11:5144404-5144426 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
1078354922 11:10626223-10626245 AGGCCCAGCTGGAGAGCCGATGG - Exonic
1078891296 11:15560913-15560935 AGGTGCGGAGGGAGAGGCGCCGG + Intergenic
1080107531 11:28526154-28526176 AGGTGTGGCGGGAGAGGCGCAGG - Intergenic
1080503118 11:32888539-32888561 AGGTGTGGAGGGAGAGGCGGGGG - Intergenic
1081047728 11:38296648-38296670 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1081136188 11:39442433-39442455 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
1081339639 11:41912219-41912241 AGGGGTGACGGGAGAGGGGAGGG - Intergenic
1082734886 11:56845187-56845209 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1083074331 11:60020587-60020609 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
1083583546 11:63839963-63839985 AAGCGAGGCAGGAGAGACGAAGG - Intronic
1083939611 11:65888572-65888594 GGACGGGGCGGGAGCGGCGAGGG + Intergenic
1084102299 11:66957857-66957879 AGCCGCGGCGTGTAAGGCGAGGG - Intronic
1084210418 11:67619029-67619051 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1084296133 11:68214149-68214171 ACGCGCGGCGGGAGGGGGGGGGG - Intergenic
1085047769 11:73363345-73363367 AGCCGTGGCTGGAGCGGCGAAGG - Exonic
1085863088 11:80257552-80257574 AGGTGCGGAGGGAGAGGCACCGG + Intergenic
1086001123 11:81987046-81987068 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1086210158 11:84308906-84308928 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1087318826 11:96635818-96635840 AGGTGCGGAGGGAGAGGCTCGGG + Intergenic
1087407351 11:97745986-97746008 AGGTGTGGAGGGAGAGGCAACGG - Intergenic
1087682380 11:101231706-101231728 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1088481743 11:110301263-110301285 AGGCCCGGAGGGAGAGGCGCGGG - Intergenic
1089496641 11:118911414-118911436 AGACACGGCTGGAGTGGCGAAGG - Intronic
1090588222 11:128237080-128237102 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1090782688 11:130021662-130021684 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1090990844 11:131815643-131815665 AGGGGCTGGGGGAGAGGCGCGGG - Intronic
1091402282 12:188445-188467 AGGTGTGGAGGGAGAGGCGCTGG - Intergenic
1091642558 12:2248545-2248567 AGTCGGTGCTGGAGAGGCGATGG + Intronic
1092133925 12:6132607-6132629 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1092366510 12:7881269-7881291 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1092545894 12:9450755-9450777 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1092732433 12:11547282-11547304 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1093524812 12:20093634-20093656 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1093583307 12:20807800-20807822 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1093793683 12:23285935-23285957 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1094327525 12:29256633-29256655 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1094507062 12:31071318-31071340 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1094841189 12:34343327-34343349 ATGCGCGGCAGGGGAGGCGGGGG - Intergenic
1095432021 12:42144665-42144687 GGGCGCGGCGGCGGCGGCGAAGG - Exonic
1095478642 12:42611148-42611170 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1095533939 12:43224312-43224334 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1096319489 12:50598881-50598903 AGGAGAGGGGGGAGAGGGGAGGG - Intronic
1096532460 12:52250328-52250350 AGGCGCGGCGTGGGGGCCGATGG + Intronic
1097036587 12:56128454-56128476 TGGCGCGGCGGGTGAGGCCCTGG + Exonic
1097253646 12:57655756-57655778 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
1097293655 12:57941480-57941502 AGGGGCGGGGCGAGAGGCGAGGG - Intergenic
1097547539 12:61023403-61023425 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1097981976 12:65744349-65744371 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1098498801 12:71166578-71166600 AGGTGTGGCGGGAGAGGCGCGGG - Intronic
1099192408 12:79573908-79573930 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1099204313 12:79710927-79710949 AGGCGTGGAGGGAGAGGCACTGG + Intergenic
1100078881 12:90824052-90824074 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1100360291 12:93871542-93871564 GGGAGCTGCGGGAGAGGTGAAGG - Intronic
1100600605 12:96108894-96108916 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1100611402 12:96194357-96194379 CGGGGCGGCGGGGGAGGCGCGGG + Intergenic
1100734658 12:97513108-97513130 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1101603812 12:106233022-106233044 AGGTGCGGAGGGAGAGGCACGGG + Intergenic
1102387273 12:112520260-112520282 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1103497524 12:121374454-121374476 AGGTGTGGAGGGAGAGGCGAGGG + Intronic
1103993017 12:124811849-124811871 AGGTGAGGGGCGAGAGGCGAGGG - Exonic
1104901159 12:132190193-132190215 CCGCGCGGCGGGAGAGGGGCCGG - Intergenic
1105541191 13:21319036-21319058 AGGCGGGGCGGGAGAGGTGGGGG + Intergenic
1105605191 13:21921027-21921049 AGGTGTGGCGGGAGAGGCACAGG - Intergenic
1106109093 13:26760942-26760964 GGGCGCGGGGCGAGGGGCGAAGG + Intergenic
1106183436 13:27387413-27387435 AGGCGCTGGGGAGGAGGCGAGGG + Intergenic
1106422433 13:29595304-29595326 GGGCGGCGCGGGAGTGGCGAGGG - Intronic
1106600587 13:31183379-31183401 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
1107091506 13:36486337-36486359 TGGGGTGGCGGGAGAGGGGAGGG - Intergenic
1107467737 13:40665528-40665550 GGGCGCGGTGGGTCAGGCGAGGG - Intronic
1107864848 13:44693666-44693688 AGTCGCTGCTGGAGAGGCAAGGG + Intergenic
1108362335 13:49678650-49678672 AGGTGTGGAGGGAGAGGCGCCGG - Intronic
1108644018 13:52408446-52408468 AGGTGTGGAGGGAGAGGCGCTGG - Intergenic
1108856560 13:54800049-54800071 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1109152157 13:58859225-58859247 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1109201831 13:59439900-59439922 AGGTGCGGAGGGAGAGGCGCAGG + Intergenic
1109563199 13:64077865-64077887 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1109854339 13:68108086-68108108 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1109858790 13:68170969-68170991 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1109884346 13:68523932-68523954 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1110751436 13:79119991-79120013 AGGCGTGGAGGGAGAGGCACGGG - Intergenic
1110854239 13:80278989-80279011 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1110913969 13:80998799-80998821 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1111103293 13:83613766-83613788 AGGTGTGGAGGGAGAGGCGGGGG - Intergenic
1111333531 13:86792254-86792276 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1111556212 13:89884197-89884219 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1111747649 13:92290878-92290900 AGGTGTGGAGGGAGAGGCGCTGG + Intronic
1112077796 13:95931807-95931829 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1113680228 13:112238684-112238706 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
1113883775 13:113646608-113646630 AGGAGCTGAGGGAGAGGGGATGG + Intergenic
1113946066 13:114044386-114044408 AGGCGGGGCGGGGGGGGCGGGGG - Intronic
1114566326 14:23635791-23635813 AGGTGTGGAGGGAGAGGCGCCGG + Intronic
1114679536 14:24473139-24473161 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1116310970 14:43326594-43326616 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1116426485 14:44798579-44798601 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1116900926 14:50361945-50361967 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
1117082555 14:52166736-52166758 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
1117183685 14:53217864-53217886 AGGTGTGGCGGGAGAGGCGGGGG - Intergenic
1117565602 14:56991056-56991078 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1117742587 14:58833919-58833941 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1117837285 14:59819914-59819936 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1117920952 14:60724460-60724482 AGGAGGGGAGGGAAAGGCGAGGG - Intergenic
1118306294 14:64658168-64658190 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1118558944 14:67057050-67057072 AGGTGTGGAGGGAGAGGCGTGGG - Intronic
1118672332 14:68143000-68143022 AGGCGCGGAGGGCGAGGGGGTGG + Intronic
1118932329 14:70254710-70254732 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1118971547 14:70642064-70642086 AGGCGCGGCGGCGGCGGCGGCGG + Exonic
1118994320 14:70822650-70822672 AGGCGGGGAGGGAGAGACGGAGG - Intergenic
1119027745 14:71167529-71167551 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1119223374 14:72926626-72926648 AGGCGCGGCGAGGAAGGCCAGGG + Intronic
1119303717 14:73590804-73590826 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1119322230 14:73738961-73738983 AGAGGCGGCGGGAGCGGCGGGGG + Exonic
1119695093 14:76707037-76707059 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
1119997721 14:79271590-79271612 AGGCACGGCAGGAGAAGGGAAGG - Intronic
1120190639 14:81436491-81436513 AGGAGCGGCGGGAGCGGCGCCGG - Intergenic
1120429802 14:84399773-84399795 AGGTGTGGCGGGAGAGGCGCGGG - Intergenic
1121447625 14:93988521-93988543 AGACGGGGTGGGAGAGGAGATGG + Intergenic
1122580855 14:102770793-102770815 AGGCTTGGAGGGAGAGGCCAGGG - Intergenic
1122666652 14:103334607-103334629 GGGCGCGGCGGGCCAGGAGATGG + Intronic
1124036333 15:26056902-26056924 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
1124061625 15:26298433-26298455 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1124110633 15:26781996-26782018 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1126165568 15:45651375-45651397 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1126639635 15:50811958-50811980 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1126703850 15:51389637-51389659 AGGAGCGGTGGGAAAGGCGGGGG + Intronic
1129158301 15:73732516-73732538 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1129189276 15:73927898-73927920 ACGCGCGGCCGGAGGGGCGCCGG - Intronic
1129208600 15:74052528-74052550 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1129423979 15:75451657-75451679 GGCCGCGGCGGTAGAGGCGGCGG - Exonic
1129540234 15:76342499-76342521 TGGCGCGGCGGGAGGGCCGGCGG + Intergenic
1129724429 15:77894343-77894365 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1129787768 15:78320769-78320791 GGGGGCGGGGGCAGAGGCGAGGG + Intergenic
1129791224 15:78341698-78341720 AGGCGGGAAGGGAGAGGTGACGG - Intronic
1130370814 15:83284363-83284385 AGGCGCGGCGGGAGGGACCGTGG - Intronic
1130952757 15:88605341-88605363 AAGCGCGGGAGGAGGGGCGACGG - Intergenic
1131012741 15:89032024-89032046 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1131133071 15:89912568-89912590 GGGCGCGGCGGCAGGGGCGCCGG + Intronic
1131472863 15:92711388-92711410 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1131846162 15:96492208-96492230 AGGTGTGGAGGGAGAGGCGCTGG - Intergenic
1131892209 15:96984480-96984502 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1131892224 15:96984530-96984552 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1131912548 15:97224237-97224259 AGGTGTGGCGGAAGAGGCGCGGG + Intergenic
1131992417 15:98104594-98104616 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1132097670 15:99000039-99000061 AGGCGTGGAGGGAGAGGCGCGGG + Intronic
1132349936 15:101133325-101133347 AGGCGAGGTGGGAGAGGAGCTGG - Intergenic
1132548534 16:544687-544709 AGGCGACGTGGGGGAGGCGACGG - Intronic
1132552911 16:560664-560686 AGGAGCGGCGGGAGCCGCGGGGG + Intronic
1132743556 16:1427641-1427663 AGGGGTGGCCGGAGGGGCGAGGG - Intergenic
1132836865 16:1958571-1958593 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1132995546 16:2820644-2820666 AGGAGCCGAGGGAGGGGCGAAGG - Intronic
1133362685 16:5186692-5186714 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1133383884 16:5353417-5353439 AGGGGCGGAGGAAGAGGGGAGGG - Intergenic
1134684472 16:16148978-16149000 AGGAGCAGCAGGAGATGCGAGGG + Exonic
1135518623 16:23156277-23156299 AGGGGAGGAGGGAGAGGAGAGGG + Intergenic
1136276754 16:29183373-29183395 AGACAGGGCGGGAGAGGCGGGGG - Intergenic
1137988576 16:53130806-53130828 AGCCGCGGCAGGAGCGGCGGCGG + Intronic
1138379425 16:56589950-56589972 GGGGGCGGCGGCAGAGGGGAAGG - Intronic
1139442276 16:66974270-66974292 AGGTGCGGAGGGAGAGGGGCGGG + Exonic
1139676387 16:68526738-68526760 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1139919628 16:70451166-70451188 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
1140563652 16:76013913-76013935 TGGGGCGGGGGGAGAGGGGAGGG - Intergenic
1141538557 16:84700267-84700289 AGGCGCGGCGGGCGCGGAGGCGG - Intronic
1141624553 16:85254398-85254420 AGGCGCTGTGGGAGAGGCTAGGG - Intergenic
1141686280 16:85571744-85571766 AGGCGTGGGGGCAGAGGCCATGG + Intergenic
1141828884 16:86498600-86498622 AGTCCCGGCGGGAGACGCGCGGG + Intergenic
1141972476 16:87492824-87492846 ACGCGCGGCGGGAGGCGCGGAGG + Intergenic
1142285790 16:89171071-89171093 AGACGCAGCCAGAGAGGCGAGGG + Intergenic
1142709579 17:1715880-1715902 GGGGGCGGGGGGAGAGCCGAGGG - Intergenic
1143135299 17:4709411-4709433 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1143708697 17:8718438-8718460 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
1144128044 17:12220892-12220914 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1144307263 17:13979777-13979799 TGGCGTGGGGGGAGAGGGGAGGG + Intergenic
1145050345 17:19654686-19654708 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1145094803 17:20016456-20016478 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1146295570 17:31647486-31647508 AGGTGCTGCGGCAGAGGAGATGG - Intergenic
1148023338 17:44568207-44568229 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1148048671 17:44758929-44758951 GGGGGCGGCGGGAGAGCGGAGGG + Intergenic
1148440374 17:47708907-47708929 CGGCGCTGCGGGACGGGCGACGG - Exonic
1149916351 17:60613604-60613626 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1150682475 17:67294740-67294762 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1150792208 17:68207848-68207870 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1151440678 17:74126868-74126890 AGGTGAGAGGGGAGAGGCGATGG - Intergenic
1151773062 17:76177521-76177543 AGGGGAAGGGGGAGAGGCGAGGG + Intronic
1151786534 17:76277962-76277984 AGGAGAGGCGGGCGAGGCCATGG - Intronic
1152625698 17:81387039-81387061 GGGCGCGGAGGGAGGGCCGAGGG + Intergenic
1152718577 17:81911505-81911527 AGGCGGGGCGGGGGAGGCGGGGG - Intergenic
1152721878 17:81927467-81927489 CGGCGCGGCGGGGGCGGCGGGGG - Intronic
1152742199 17:82023281-82023303 AGGCGCGCCGGGAGAGGCCGCGG - Exonic
1154057285 18:11024016-11024038 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1154097637 18:11432661-11432683 AGGTGCGGAGGGAGAGGCGCCGG - Intergenic
1154128789 18:11717260-11717282 AGGCGGGGAGGGAGAGGTGCCGG - Intronic
1154231468 18:12559457-12559479 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1154503665 18:15010459-15010481 AGGCGCGGCGGCGGCGGCGGCGG + Intergenic
1155402681 18:25456488-25456510 AGGCACGGTGGGAGGGGCGCTGG + Intergenic
1155806341 18:30175488-30175510 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1156079473 18:33316218-33316240 AGGTGTGGAGGGAGAGGCGCCGG + Intronic
1156150309 18:34233948-34233970 AGGCGTGGAGGGAGAGGCGCGGG + Intergenic
1156452696 18:37275412-37275434 AGTCGGAGCGGGAGGGGCGAGGG + Intronic
1156683534 18:39618446-39618468 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
1156969634 18:43139512-43139534 AGGTGTGGAGGGAGAGGCAAGGG + Intergenic
1158282341 18:55841065-55841087 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1158478737 18:57802903-57802925 AAGTGCGGCGGGAGCGGCCAGGG + Intronic
1159260525 18:66006325-66006347 AGGTGTGGAGGGAGAGGCGGGGG - Intergenic
1159289282 18:66395812-66395834 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1159322183 18:66866690-66866712 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1159406811 18:68013586-68013608 CGGGGCGGGGGGAGAGGGGAGGG + Intergenic
1159670246 18:71212848-71212870 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1160698847 19:496909-496931 AGGGGGCGCGGGAGAGGGGAGGG + Intronic
1160698951 19:497235-497257 AGGGGGCGCGGGAGAGGGGAGGG + Intronic
1160699034 19:497445-497467 AGGGGGCGCGGGAGAGACGAGGG + Intronic
1160769179 19:822533-822555 CGGCGCGGCGGAGGGGGCGAGGG - Intergenic
1160810662 19:1011608-1011630 GGGCGCTGCGGGGAAGGCGATGG + Exonic
1160853508 19:1205938-1205960 ACGCGCGGCGGCCGCGGCGAGGG + Intronic
1161347369 19:3775032-3775054 AGGCGCGGCGGGGGGGGCTTTGG + Intergenic
1161420345 19:4173176-4173198 AGCAGCGGAGGGAGAGGCGCCGG + Intergenic
1161471142 19:4457359-4457381 GGGCGCGGCGGGGGAGGCGAGGG - Intronic
1162022419 19:7873945-7873967 AGCCGAGGCGGGGGAGGCGGTGG - Intronic
1162091130 19:8280723-8280745 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1162093364 19:8295561-8295583 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1162315603 19:9936474-9936496 CGGCGAGGCGGGGGAGGCGGCGG - Exonic
1162372934 19:10289870-10289892 GGGGGCGGCGGCAGAGGCGGCGG - Intergenic
1162778642 19:12995564-12995586 ACGCGCGGCGGCAGCGGCGGCGG + Intergenic
1163390563 19:17027456-17027478 AGGCCCAGCGAGAGAGGGGACGG - Intergenic
1163607095 19:18281485-18281507 CGGCGCGGCGGGGGAGGCGGAGG - Exonic
1164581929 19:29440003-29440025 AGGTGAGGAGGGAGAGGCGCAGG + Intergenic
1165109650 19:33494238-33494260 AGGGGTGTGGGGAGAGGCGAGGG - Intronic
1165415571 19:35691430-35691452 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1165846547 19:38821487-38821509 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1166095947 19:40539265-40539287 AGGCTCAGAGGGAGAGACGAAGG - Intronic
1166361328 19:42254041-42254063 GGGGGCGGCGGGGGAGGGGAGGG + Intronic
1166708037 19:44919378-44919400 AGGGGCTGCGGGAGAGGGTAGGG + Intergenic
1167158956 19:47755448-47755470 TGGCGCGGCGGCAGAGGCGGCGG + Exonic
1167964354 19:53131647-53131669 AGGAGCAGCAGGAGAGGAGAGGG - Intronic
1168076429 19:53982850-53982872 GGGCGCGGCGGGGGAGCCGAGGG + Exonic
1168434465 19:56306282-56306304 TGGCGATGCGGGAGAGGCCAGGG - Intronic
1168434635 19:56307206-56307228 AGGCGACGTGGGAGAGGCCAGGG - Intronic
924967340 2:90982-91004 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
924977515 2:191713-191735 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
925532940 2:4884211-4884233 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
925929229 2:8694040-8694062 AGGGGCGGTGGGAGTGGTGACGG + Intergenic
926217877 2:10916147-10916169 AGGGAGGGCGGGAGAGGCCAGGG + Intergenic
926474809 2:13308661-13308683 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
926850630 2:17193544-17193566 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
927137392 2:20106898-20106920 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
927596553 2:24402850-24402872 AGGTGCGGAGGGAGAGGCGCGGG + Intergenic
927777766 2:25915491-25915513 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
927900391 2:26814461-26814483 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
927964882 2:27262526-27262548 AGGCGCCGCGGGGGTGGCGGAGG + Intronic
928341628 2:30447643-30447665 AGGGGCCGCGCGAGCGGCGAGGG + Intronic
928880542 2:36092231-36092253 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
930189209 2:48440809-48440831 AGGCGCGGCGGCGGCGGCGGCGG + Exonic
931106934 2:59066918-59066940 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
931475261 2:62581025-62581047 TGGGGTGGCGGGAGAGGGGAGGG - Intergenic
932496409 2:72147866-72147888 GGCCGCGGCGGGGGAGGGGAGGG + Exonic
932699897 2:73985197-73985219 AGGGGCGGCGGGAGGCGCGGGGG + Intergenic
932983511 2:76698490-76698512 AGGTGCGAAGGGAGAGGCGCGGG - Intergenic
933712184 2:85334721-85334743 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
934085087 2:88503128-88503150 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
934993367 2:98936467-98936489 AGGCGGGTCGGGAGCGGCGCGGG - Intergenic
936122681 2:109760389-109760411 AGGCGGGGCGGGGGCGGCGGCGG + Intergenic
936172739 2:110190563-110190585 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
936222012 2:110611084-110611106 AGGCGGGGCGGGGGCGGCGGCGG - Intergenic
936581566 2:113704775-113704797 AGGTGTGGAGGGAGAGGCGAGGG - Intergenic
937181098 2:119996973-119996995 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
937716277 2:125037325-125037347 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
937751464 2:125479527-125479549 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
938018312 2:127885724-127885746 AGGCCCGGCGGGCAAGGCGGCGG + Intronic
938026777 2:127956215-127956237 AGGCGTGCCTGGAGAGGCCATGG + Intronic
938728739 2:134129932-134129954 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
938931239 2:136088393-136088415 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
939047304 2:137264968-137264990 TGGCGTGGGGGGAGAGGGGAGGG - Intronic
939275250 2:139991069-139991091 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
940145829 2:150542914-150542936 AGGTGCGGAGGGAGAGGCATAGG - Intergenic
941367031 2:164621571-164621593 AGGCGCGGAGGGGGCGGGGAGGG + Exonic
941476631 2:165957438-165957460 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
941928100 2:170915719-170915741 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
942170296 2:173282958-173282980 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
942241007 2:173964329-173964351 AGGAGGGAGGGGAGAGGCGAGGG + Intronic
942368704 2:175257373-175257395 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
943134398 2:183892524-183892546 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
943790013 2:191921647-191921669 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
943942684 2:194020151-194020173 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
943954877 2:194176304-194176326 AGGTGTGGAGGGAGAGGCAAGGG + Intergenic
944058523 2:195547682-195547704 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
944252519 2:197591913-197591935 AGGCGTGGAGGGAGAGGCACGGG - Intronic
944688244 2:202136710-202136732 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
945069609 2:205977220-205977242 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
945302601 2:208228054-208228076 AGGTGTGGAGGGAGAGGCGCTGG - Intergenic
945664260 2:212721433-212721455 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
945907929 2:215615256-215615278 AGGTGAGGAGGGAGAGGCGCGGG - Intergenic
946053955 2:216885239-216885261 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
946376467 2:219312810-219312832 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
946692485 2:222319757-222319779 AGGCGCGGCGGCAGCGGCGGCGG + Intergenic
946929106 2:224655288-224655310 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
947171879 2:227320617-227320639 AGGTGTGGGGGGAGAGGCGCAGG + Intergenic
947463721 2:230323867-230323889 TGGCGCGGAGGAAGAGGCTATGG - Intergenic
947539394 2:230964606-230964628 AGGCGCGGAAGGAGAGACGCGGG - Intergenic
947741725 2:232487824-232487846 CGGCGCGGCGGCAGAGGAGGCGG - Exonic
948047201 2:234953013-234953035 AGGAGCCGCGGGAGAGCCGCCGG + Intronic
948820057 2:240538271-240538293 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
948951485 2:241255123-241255145 AGGGGCGGCGACAGAGGAGACGG + Exonic
1169630269 20:7622816-7622838 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1170230906 20:14045153-14045175 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1170756803 20:19212485-19212507 CGGCGCGGCGGGGGCGGCGGGGG - Intergenic
1171865989 20:30488033-30488055 GGGCGCGGCAGGGCAGGCGATGG + Intergenic
1172100994 20:32483822-32483844 AGGCGCGGGGGGAGAAGAGGAGG + Intronic
1172608200 20:36229990-36230012 AGGGGAGGCGGGAGAGAGGAAGG - Exonic
1172848414 20:37944159-37944181 GGGCGCGGCGGGAGGGGCTTCGG - Exonic
1173670581 20:44796086-44796108 AGGCACGGCAGGGGAGGGGAGGG - Intronic
1174092241 20:48058764-48058786 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1174162921 20:48564433-48564455 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1174468012 20:50731924-50731946 CGGAGCGCCGGGGGAGGCGACGG + Intronic
1174645410 20:52081063-52081085 AGGTGGGGTGGGAGAGGCCATGG + Intronic
1175281180 20:57805044-57805066 AAGAGAGGCGGGAGAGGCGGTGG - Intergenic
1175782021 20:61688999-61689021 AGGCGAGGAGGGAGCTGCGAAGG - Intronic
1176189344 20:63800553-63800575 AGGTGTGGAGGGAGAGGCGTGGG + Intronic
1176234832 20:64049373-64049395 GGGCGCGGCGGGCGCGGCGAGGG + Exonic
1176548929 21:8213330-8213352 AGGGGCGGCGGGGGAGGAGGAGG - Intergenic
1176549259 21:8214435-8214457 AGGGGCGGCGGGGGAAGGGAGGG - Intergenic
1176557152 21:8258658-8258680 AGGGGCGGCGGGGGAAGGGAGGG - Intergenic
1176567858 21:8396363-8396385 AGGGGCGGCGGGGGAGGAGGAGG - Intergenic
1176568191 21:8397473-8397495 AGGGGCGGCGGGGGAAGGGAGGG - Intergenic
1176576094 21:8441693-8441715 AGGGGCGGCGGGGGAAGGGAGGG - Intergenic
1177318691 21:19493599-19493621 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
1177549060 21:22597791-22597813 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1177795866 21:25778357-25778379 AAGCGTGGAGGGAGAGGCGCGGG + Intergenic
1178074141 21:29000166-29000188 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1179084924 21:38207804-38207826 AGGAGAGGGGGGAGAGGGGATGG - Intronic
1179150588 21:38805693-38805715 GGGAGCGGAGGGAGAGGAGAGGG - Intronic
1179411489 21:41167183-41167205 GGGCGCGGCGGAGGGGGCGAAGG + Intergenic
1180156669 21:45981624-45981646 AGGGGCGGGAGGAGAGGGGAGGG - Intergenic
1180739652 22:18044174-18044196 AGGTGCTGTGGGAGAGGCGGAGG + Intergenic
1180796921 22:18610428-18610450 GGTGGCGGCGGGAGTGGCGATGG + Exonic
1180831891 22:18910852-18910874 GGGGGCGGCGGGGGAGGTGAGGG - Intronic
1181077701 22:20392727-20392749 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1181224803 22:21384843-21384865 GGTGGCGGCGGGAGTGGCGATGG - Exonic
1181253829 22:21549970-21549992 GGTGGCGGCGGGAGTGGCGATGG + Exonic
1181800919 22:25347277-25347299 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1182295984 22:29311483-29311505 AGTAGCGGCGGGAGCGGGGATGG - Intronic
1182547678 22:31085285-31085307 AGGCAGGGTGGGCGAGGCGAGGG + Intronic
1182639298 22:31753910-31753932 AGGCCCGGCGAGAGCGGCGCGGG + Intergenic
1183248164 22:36709928-36709950 AGGCCCTGGGGGAGAAGCGAGGG - Intergenic
1183483265 22:38076194-38076216 AGGGGCGTGGGGAGAGGCCATGG + Intergenic
1183486222 22:38089048-38089070 AGGAGGGCCGGGAGAGGCGCGGG - Intronic
1184557472 22:45240991-45241013 AGGCGGGGCGGGAGGGGACAGGG - Intergenic
1203254144 22_KI270733v1_random:130751-130773 AGGGGCGGCGGGGGAAGGGAGGG - Intergenic
1203262200 22_KI270733v1_random:175830-175852 AGGGGCGGCGGGGGAAGGGAGGG - Intergenic
1203281969 22_KI270734v1_random:136123-136145 GGGGGCGGCGGGGGAGGTGAGGG - Intergenic
950204888 3:11071593-11071615 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
950524634 3:13516701-13516723 AGGCCAGGCGGGGGAGGCGGGGG + Intergenic
950601191 3:14037188-14037210 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
950632600 3:14293197-14293219 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
950679727 3:14576479-14576501 AGGAGGGCGGGGAGAGGCGAGGG + Intergenic
951551915 3:23882905-23882927 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
951734761 3:25851755-25851777 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
952076277 3:29701567-29701589 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
952713276 3:36453335-36453357 AGGTGTGGAGGGAGAGGCGTGGG + Intronic
953674109 3:44986467-44986489 AGGTGTGGAGGGAGAGGCGTGGG - Intronic
953748784 3:45594353-45594375 ACGCGCGGCGGCTGAGGCGCAGG - Intronic
954004229 3:47578910-47578932 CGGCGCGGCGGGCGGGGTGAGGG - Exonic
954089368 3:48272293-48272315 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
954779100 3:53046138-53046160 GGGCGCGGCGCGAGGGGCGCAGG - Intronic
956678038 3:71753717-71753739 AGGCGCGGCGGCAGCAGCGGAGG + Intronic
957209468 3:77240454-77240476 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
957446101 3:80314493-80314515 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
957919899 3:86733448-86733470 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
958549684 3:95595851-95595873 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
958810788 3:98858294-98858316 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
959323306 3:104906128-104906150 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
960560078 3:119073771-119073793 AGGTGTGGAGGGAGAGGCGTGGG - Intronic
960789993 3:121418416-121418438 AGGCGCTGCTGGAGGGGTGATGG + Exonic
960868622 3:122227546-122227568 AGGTGTGGAGGGAGAGGCGTGGG - Intronic
961268740 3:125671668-125671690 AGGTGCGGAGGGAGAGGCGCAGG + Intergenic
961458061 3:127033950-127033972 AGGCGCGGCGGCAGCGGCTGCGG + Exonic
961461995 3:127056476-127056498 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
961664335 3:128486749-128486771 AGGCGCCGCGCGCCAGGCGAGGG - Intronic
961746757 3:129068639-129068661 AGGTGTGGAGGGAGAGGCGGGGG - Intergenic
962106596 3:132396412-132396434 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
962177285 3:133167762-133167784 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
962998097 3:140651414-140651436 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
963397845 3:144756876-144756898 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
963554624 3:146772336-146772358 AGGTGTGGAGGGAGAGGCGGGGG + Intergenic
963583305 3:147154077-147154099 AGGTGTGGAGGGAGAGGCGGGGG + Intergenic
963651863 3:147989750-147989772 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
963673541 3:148280888-148280910 AGGTGTGGCGGGAGAGGCGCGGG - Intergenic
963760554 3:149284011-149284033 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
963904693 3:150763497-150763519 AGGCGGGGCGGGAGCGTGGACGG + Intergenic
964118976 3:153162667-153162689 AGGCGCGGCGAGAGCGCTGACGG + Exonic
964129210 3:153268676-153268698 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
964265419 3:154889610-154889632 AGGCGTGGAGGGAGAGGCGTGGG - Intergenic
964375015 3:156041309-156041331 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
964376225 3:156051768-156051790 AGGTGTGGAGGGAGAGGCGCTGG + Intronic
964378491 3:156073151-156073173 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
964381062 3:156099458-156099480 AGGTGTGGAGGGAGAGGCGTGGG + Intronic
965092210 3:164179243-164179265 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
965139220 3:164814242-164814264 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
965160471 3:165127331-165127353 AGGAGCGGGGGGAGAAGCTAAGG - Intergenic
965652321 3:170947213-170947235 AGGTGTGGTGGGAGAGGCGCAGG + Intergenic
965744248 3:171907420-171907442 AGGTGTGGAGGGAGAGGCGCCGG - Intronic
965943527 3:174212342-174212364 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
966246115 3:177809266-177809288 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
966372452 3:179263378-179263400 AGGTGGGGAGGGAGAGGCGCGGG - Intronic
966425497 3:179775859-179775881 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
966548996 3:181183357-181183379 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
966712037 3:182980734-182980756 GGGCGCGGCGGGGGAGGGGCGGG + Intronic
967718305 3:192789022-192789044 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
968114980 3:196082252-196082274 GGGCGCTGCGGGCGAGGCGAAGG + Intergenic
968178162 3:196568966-196568988 AGGGCCGGCTGGTGAGGCGATGG + Exonic
968412836 4:404329-404351 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
968459564 4:717833-717855 AGGGGCAGAGGGAGAGGCAAAGG + Intronic
968505190 4:968175-968197 GGGCGGGGCAGGAGAGGCGCGGG - Intronic
968889335 4:3359287-3359309 AGGGGAGGAGGGAGAGGAGAGGG - Intronic
969344730 4:6563627-6563649 GGGCGCGGCGGGCGCGGCGGGGG + Intergenic
969814895 4:9679852-9679874 AGGTGCAGAGGGAGAGGCGCGGG + Intergenic
970108282 4:12609624-12609646 AGGTGTGGAGGGAGAGACGAGGG + Intergenic
970182560 4:13415389-13415411 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
970260160 4:14216092-14216114 AGGGGCAGCGTGAGAGGCCAGGG + Intergenic
970456140 4:16226269-16226291 ACCGGCGGCGGGAGAGGCGCCGG - Exonic
971457931 4:26861319-26861341 CGCCGCGGCGGGAGAGGAGGCGG - Exonic
971564231 4:28117511-28117533 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
971792391 4:31185340-31185362 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
971852057 4:31996379-31996401 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
972344603 4:38182569-38182591 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
973686767 4:53377995-53378017 AGCGGCGGCGCGAGAGGCCAGGG - Intronic
973764349 4:54149669-54149691 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
974089921 4:57300539-57300561 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
974186757 4:58456922-58456944 AGGTGTGGAGGGAGAGGCGCTGG + Intergenic
974207411 4:58724126-58724148 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
974807599 4:66899829-66899851 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
975160665 4:71120918-71120940 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
975485750 4:74933056-74933078 AGGCGCGGCGGCGGCGGCGGAGG + Intergenic
975994903 4:80302828-80302850 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
976099854 4:81550194-81550216 AGGAGCAGCGGGAGAGGCTGTGG - Intronic
976102461 4:81580441-81580463 AGGTGTGGAGGGAGAGGCGGGGG + Intronic
976565501 4:86547310-86547332 AGGTGTGGAGGGAGAGGCGCTGG + Intronic
976690643 4:87864035-87864057 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
976736321 4:88313515-88313537 AGGTGTGGAGGGAGAGGTGAAGG - Intergenic
976846036 4:89490047-89490069 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
977694451 4:99950457-99950479 GGGCGTGGGGGGAGAGGCGGGGG + Intergenic
977885125 4:102245033-102245055 AGGCGTGGAGGGAGAGGCATGGG + Intergenic
978463652 4:108984722-108984744 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
978466217 4:109012464-109012486 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
978492279 4:109322141-109322163 TGGGGTGGCGGGAGAGGGGAGGG + Intergenic
978809049 4:112830797-112830819 AGGTGTGGAGGGAGAGGCGTGGG + Intronic
978886511 4:113772326-113772348 AGGTGTGGAGGGAGAGGCGCTGG + Intergenic
978918014 4:114148927-114148949 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
978929819 4:114296462-114296484 AGGCTTGGAGGGAGAGGCGTGGG - Intergenic
978944773 4:114482051-114482073 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
979678648 4:123435739-123435761 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
979822521 4:125191941-125191963 AGGTGTGGGGGGAGAGGCGCAGG + Intergenic
980075150 4:128287235-128287257 AGGTGCGGCGGCCGAGGCGCGGG + Intronic
980115182 4:128672653-128672675 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
980739230 4:136929005-136929027 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
981136158 4:141213524-141213546 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
982148873 4:152429378-152429400 GGGGGCGGCGGGGGAGGAGAGGG + Intronic
983834276 4:172369840-172369862 AGGTGTGGAGGGAGAGGCGTGGG - Intronic
983843220 4:172482242-172482264 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
984266114 4:177499664-177499686 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
984703438 4:182833029-182833051 AGGAGGAGGGGGAGAGGCGAAGG - Intergenic
984901711 4:184591899-184591921 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
984972584 4:185204034-185204056 CGGCGCTTCGGGAGAGGCGGGGG + Intronic
984995479 4:185426294-185426316 CTGCGCTGCGGGAGCGGCGAGGG - Intronic
985269262 4:188178969-188178991 AGGTGTGGAGGAAGAGGCGAGGG + Intergenic
985323002 4:188735261-188735283 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
985423579 4:189807257-189807279 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
985658056 5:1142296-1142318 AGGGGAGACGGGAGGGGCGAGGG - Intergenic
985784429 5:1886597-1886619 GGGCGCAGCGGGAGAGAGGAGGG - Intronic
985995743 5:3596043-3596065 AGGCGCGGGGAGGGAGGCGGAGG - Exonic
986661699 5:10065470-10065492 AGGTGTGGAGGGAGAGGCCACGG + Intergenic
987258380 5:16179840-16179862 AGGGGGGGCCGGAGAAGCGAGGG + Intronic
987352318 5:17032762-17032784 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
987355819 5:17062222-17062244 AGGCGCGGAGGGAGAGGCGAGGG + Intergenic
987696563 5:21341386-21341408 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
988177222 5:27743452-27743474 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
988755640 5:34245184-34245206 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
990665749 5:58069480-58069502 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
990880189 5:60530310-60530332 AGGTGTGGAGGGAGAGGCGCTGG + Intergenic
991743891 5:69710955-69710977 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
991753818 5:69844287-69844309 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
991795463 5:70290687-70290709 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
991803435 5:70401014-70401036 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
991823261 5:70586223-70586245 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
991833134 5:70719400-70719422 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
991887830 5:71290206-71290228 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
991913914 5:71587463-71587485 CGGCCCGGCGGGAGAGGCGCGGG - Exonic
992050324 5:72935229-72935251 AGGTGTGGAGGGAGAGGCGGGGG + Intergenic
992487420 5:77210361-77210383 GGGAGCGGCGGGAGGGGCGGAGG + Intergenic
992663606 5:78984895-78984917 AGGCGGGGCGGGGGCGGCGCGGG + Intronic
993168385 5:84384662-84384684 AGGCGCGGCGGGCGGGGCGCGGG + Exonic
993454176 5:88108225-88108247 TGGGGAGGCGGGAGAGGGGAGGG + Intergenic
993905692 5:93621175-93621197 AGGCGCGGTGAGGGCGGCGAGGG + Intronic
994669713 5:102752058-102752080 AGGTGTGGAGGGAGAGGCGAGGG + Intergenic
994710405 5:103258749-103258771 GAGCGCGGTGGGAGAGGAGAGGG + Exonic
995112410 5:108442408-108442430 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
995206690 5:109488172-109488194 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
995326440 5:110894356-110894378 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
995462659 5:112419652-112419674 GGGCGCAGGGGCAGAGGCGAAGG + Intergenic
996221361 5:120936811-120936833 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
996298594 5:121954321-121954343 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
996530358 5:124521614-124521636 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
996747138 5:126854899-126854921 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
996815536 5:127569446-127569468 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
997641169 5:135449768-135449790 GGTGACGGCGGGAGAGGCGAGGG + Exonic
998409247 5:141896615-141896637 GGGCGCGGCGGGTGACGGGACGG + Intergenic
998691728 5:144595124-144595146 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
999767929 5:154755281-154755303 CGACGCGGCGGGCGAGGGGAGGG - Intronic
1000085831 5:157886847-157886869 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1000212328 5:159119164-159119186 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1001313024 5:170624729-170624751 AGGTGGGGGGGGAGAGGGGAGGG + Intronic
1002559555 5:180072030-180072052 GGACGCGGCGGGGGAGGGGAAGG + Exonic
1002616407 5:180459163-180459185 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1002782554 6:378812-378834 AGGCACTGTGGGAGAAGCGAAGG + Intergenic
1002817671 6:694618-694640 AGGTGTGGAGGGAGAGGCGCTGG + Intergenic
1003213709 6:4090133-4090155 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1003284888 6:4725675-4725697 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1003578329 6:7317103-7317125 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1003824875 6:9942166-9942188 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1003908012 6:10720262-10720284 AGGCGTGGAGGGAGAGGCGCAGG - Intergenic
1004250275 6:14018026-14018048 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1004811789 6:19270776-19270798 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
1004861413 6:19807337-19807359 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
1004864117 6:19837235-19837257 GGGCGCGGAGGGAGAGGCGAGGG - Intergenic
1004883668 6:20032337-20032359 AGGTGCGGAGGGAGAGTCGCAGG + Intergenic
1004906174 6:20239054-20239076 AGGGGTGGAGGGAGAGGCGCGGG + Intergenic
1004914605 6:20320207-20320229 AGGTGCGGCAGGAGAGGCACGGG + Intergenic
1005059248 6:21761150-21761172 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1005554278 6:26956959-26956981 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1005561407 6:27045277-27045299 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1005960024 6:30687595-30687617 AGGAGCGGCAGGAGATGGGAAGG - Exonic
1006127929 6:31852048-31852070 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1006351136 6:33521855-33521877 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1006642534 6:35496603-35496625 ACGGACGGCGGGACAGGCGACGG + Intronic
1006671440 6:35731947-35731969 GGGCGCGGCGGGAGTGGGGGAGG + Intergenic
1007619413 6:43202991-43203013 AGGCTCTGCGGGAGAAGTGAAGG + Intronic
1008629278 6:53348397-53348419 GCGCGCGGCGGGAGAGCCGGGGG - Intronic
1009402720 6:63275299-63275321 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1009746651 6:67825393-67825415 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1010083093 6:71886696-71886718 AGGCGCGGCGGGAGAGGCGAGGG - Intronic
1010277983 6:73990999-73991021 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1011178094 6:84587423-84587445 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1011338384 6:86285145-86285167 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1011410359 6:87060126-87060148 AGGTGTGGAGGGAGAGGCAAGGG - Intergenic
1011825767 6:91303498-91303520 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
1012437101 6:99226393-99226415 AGGCGGGGAGTGAGAAGCGAAGG - Intergenic
1013067714 6:106699751-106699773 AGGAGCAGCGGGAGAGAAGAGGG - Intergenic
1013694855 6:112689760-112689782 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1013963481 6:115928408-115928430 AGGCGTGGAGGGAGAGGCACGGG - Intergenic
1014280773 6:119440991-119441013 AGGCGTGGAGGGAGAGGCACGGG + Intergenic
1016104765 6:140148489-140148511 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1016859097 6:148698950-148698972 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1017310081 6:152966298-152966320 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
1017738125 6:157381643-157381665 AGGCGCGGCCGGGGAGCCGGGGG + Exonic
1018875338 6:167817558-167817580 AGGAGCGGAGGGAGAGGGAAGGG + Intergenic
1019086192 6:169480027-169480049 AGGTGTGGAGGGAGAGGCGTGGG + Intronic
1019453064 7:1109699-1109721 GGGCCCGGCGGGGGAGGGGAAGG - Intronic
1019589706 7:1824637-1824659 AGGACCCGCGGGAGAGGAGAGGG + Intronic
1019618388 7:1977487-1977509 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1020070506 7:5223899-5223921 TGGCGTGGCGGGAGAGGCACAGG - Intronic
1020689617 7:11338378-11338400 AGGGGCGGGGGGAGAGGGGTGGG + Intergenic
1020784480 7:12556527-12556549 AGGTGTGGAGGGAGAGGCGCTGG - Intergenic
1021065796 7:16170941-16170963 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1021573837 7:22090323-22090345 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
1022174178 7:27857381-27857403 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1022519069 7:30994371-30994393 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1023181771 7:37492082-37492104 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1023672989 7:42599241-42599263 AGGCATGGCTGGAGAGGCCATGG - Intergenic
1024089016 7:45920583-45920605 AGGCGCTCCGGGAAAGGTGAAGG - Intronic
1025872625 7:65449173-65449195 AGGAGAGGAGGGAGAGGGGAGGG - Intergenic
1026237035 7:68535470-68535492 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
1026516527 7:71077981-71078003 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1027956012 7:84880574-84880596 AGGCGCCGAGGGAGAGGCGCCGG + Intergenic
1028058776 7:86282523-86282545 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1028303329 7:89229097-89229119 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1028727140 7:94100884-94100906 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1029373235 7:100162616-100162638 AGGGGAGGGGGGAGAGGGGAGGG + Intronic
1029407051 7:100381719-100381741 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1029587893 7:101487031-101487053 AGGCGTGGGAGGAGAGGCCAGGG + Intronic
1030121247 7:106112413-106112435 TGGGGCGGCTGGGGAGGCGAGGG + Intronic
1030292656 7:107887978-107888000 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1030772256 7:113488495-113488517 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1031109932 7:117596139-117596161 AGGTGTGGAGGGAGAGGCGCTGG + Intronic
1031253172 7:119413697-119413719 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1031586352 7:123535167-123535189 AGGGGCGGGGCCAGAGGCGAAGG + Intergenic
1031605559 7:123763540-123763562 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1031902830 7:127429157-127429179 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
1032183908 7:129706696-129706718 AGGCCTGGTGGGAGAGCCGAAGG + Intronic
1032437077 7:131909318-131909340 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1032611847 7:133423738-133423760 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1033065046 7:138146155-138146177 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1033312468 7:140271674-140271696 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
1033759585 7:144424408-144424430 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
1034100393 7:148445594-148445616 AGGTGCGGAGGGAGAGGTGCGGG - Intergenic
1034475491 7:151279327-151279349 AGGCGCGGGGGAAGGGGCGTGGG - Intergenic
1034618153 7:152436208-152436230 GGGCCCGGCGGGGGCGGCGAGGG + Intergenic
1034967147 7:155398518-155398540 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1035282537 7:157787022-157787044 AGGTGCGGCGGGGGACGCGGGGG + Intronic
1035374025 7:158395679-158395701 GGGCGAGGCGCGAGGGGCGAGGG + Intronic
1035432042 7:158829564-158829586 ACGCGGGGCGGGAGCGGCGTGGG + Exonic
1035463940 7:159063500-159063522 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1035615852 8:1000851-1000873 AGGTGTGGGGGGAGAGGAGAGGG + Intergenic
1035683605 8:1507495-1507517 AGGCGTGGAGGGAGAGGTGTGGG - Intronic
1036123860 8:6045387-6045409 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1036390271 8:8318814-8318836 AGGCGGGGCGGCAGAGGAGCAGG + Exonic
1036554689 8:9848125-9848147 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1036561564 8:9903841-9903863 AGGCGCGGGGAAAGGGGCGAGGG - Intergenic
1036664796 8:10731127-10731149 AGGGGCGGCGGGGGCGTCGAGGG - Intronic
1036928690 8:12931674-12931696 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1038050480 8:23805857-23805879 AGGAGCAGCAGGAGAGGGGAAGG - Intergenic
1039542301 8:38382235-38382257 GGCGGCGGCGGGAGAGGCGGCGG - Exonic
1039587578 8:38719856-38719878 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1040638786 8:49306503-49306525 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1040794138 8:51271232-51271254 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1041068181 8:54102000-54102022 AGGGGCGGCGGGCGAGGGGCAGG - Exonic
1041145843 8:54875219-54875241 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1041244757 8:55879833-55879855 CGGCGCGGCGGGAGAGGAACTGG - Exonic
1043472751 8:80578501-80578523 AGCGCCGGCGGGAGAGGGGAAGG - Intergenic
1043621074 8:82192619-82192641 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
1043640129 8:82441413-82441435 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1043857120 8:85276053-85276075 AGGTGTGGAGGGAGAGGCGTGGG + Intronic
1044404853 8:91816354-91816376 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
1044459687 8:92429599-92429621 AGGCACGGAAGGAGAGGCGCAGG - Intergenic
1044551783 8:93520610-93520632 GGGGGCGGAGGGAGAGGGGAGGG + Intergenic
1044857724 8:96493744-96493766 AGGCGCGGCGCGGGAGGAGGAGG + Exonic
1045306059 8:100957477-100957499 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1045510720 8:102810448-102810470 GGGCGCGGCGGGACAGGGAACGG + Intergenic
1045583379 8:103501399-103501421 CAGCGCGGCGGGAAAGGAGAGGG - Intronic
1045678451 8:104633254-104633276 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1046621181 8:116531078-116531100 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1047124696 8:121948027-121948049 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1047594700 8:126366494-126366516 TGGCGGGGCGGGAGTGGCGGTGG - Intergenic
1048655450 8:136530779-136530801 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1049157668 8:141076678-141076700 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1049162198 8:141104761-141104783 AGGCCCAGCGAGAGAGGGGATGG + Intergenic
1049647025 8:143740137-143740159 GGGCGCGGCGGGAGGGGCTCGGG - Intergenic
1049827191 8:144676739-144676761 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
1049857901 8:144875161-144875183 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
1050294872 9:4195288-4195310 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1051240457 9:15050094-15050116 AGGGGAGGCGGGGGAGGTGAGGG + Intergenic
1051549812 9:18315699-18315721 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1052313396 9:27092645-27092667 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1052824886 9:33167353-33167375 AGGCGCCGGCGGAGAGGGGAGGG + Exonic
1052903792 9:33817217-33817239 CTGCGCGGGGGGAGGGGCGACGG - Intergenic
1054905703 9:70412568-70412590 GGGCGGGGCGGGACAGGGGAGGG + Intronic
1055462102 9:76528887-76528909 AGGTGTGGAGGCAGAGGCGAGGG - Intergenic
1055925585 9:81507365-81507387 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1056154055 9:83817565-83817587 GGGAGCCGCGGGAGAGGCGGCGG - Exonic
1056356442 9:85805528-85805550 GGGAGCCGCGGGAGAGGCGGCGG + Intergenic
1056735901 9:89209394-89209416 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1056743707 9:89282422-89282444 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1057224331 9:93281066-93281088 AGGCGTGGCAGGAAAGGAGAGGG + Intronic
1057300668 9:93879932-93879954 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic
1057726877 9:97574209-97574231 AGGTGTGGAGGGAGAGGCGCCGG + Intronic
1058075456 9:100646023-100646045 AGGGGTGGGGGGAGAGGGGAGGG - Intergenic
1058235724 9:102487308-102487330 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1058379606 9:104363270-104363292 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
1058585404 9:106501661-106501683 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1058727481 9:107817784-107817806 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1059391894 9:114004480-114004502 AGGGGCTGCTGGAGAGGCCAGGG - Intronic
1059447990 9:114350918-114350940 AGGCGCAGCGGCAGGGGCGGGGG + Exonic
1059891484 9:118809585-118809607 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1060091314 9:120746370-120746392 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1060305414 9:122406524-122406546 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1061080175 9:128365196-128365218 AGGGTCGGCTGGGGAGGCGAGGG - Intergenic
1061363345 9:130157477-130157499 AGGTGGGGCGGGAGGGGCGGGGG - Intergenic
1061616370 9:131782497-131782519 AGGAGCAGCAGGAGAGGGGAAGG - Intergenic
1061774045 9:132948794-132948816 TGGTGCGGAGGGAGAGGAGACGG - Intronic
1062177941 9:135174706-135174728 AGGCGTGGCTGGAGAGCAGAGGG - Intergenic
1062360058 9:136183387-136183409 AGGAGCGGGGAGAGAGGCGTGGG - Intergenic
1062372668 9:136248031-136248053 AGGCAGGGCGGGGGAGGGGAAGG + Intergenic
1062612861 9:137382875-137382897 AGGCTGGGCGGGAGAGGCCAGGG - Intronic
1062729450 9:138100986-138101008 AGGCGTGGCGGCGGAGGTGAGGG - Intronic
1203470545 Un_GL000220v1:113895-113917 AGGGGCGGCGGGGGAAGGGAGGG - Intergenic
1203478366 Un_GL000220v1:157867-157889 AGGGGCGGCGGGGGAAGGGAGGG - Intergenic
1185608483 X:1380548-1380570 AGGAGGGGGAGGAGAGGCGAGGG + Intronic
1185695179 X:2188716-2188738 AGCCGCGGGGGGAGTGGGGATGG + Intergenic
1186293149 X:8121579-8121601 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1186295676 X:8145277-8145299 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
1188111969 X:26204793-26204815 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1188166993 X:26874030-26874052 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1188466000 X:30481909-30481931 AGGCGGGGCGGGTGAGGGGGTGG - Intergenic
1188881769 X:35499266-35499288 AGGTGAGGAGGGAGAGGCGCGGG + Intergenic
1189187931 X:39070193-39070215 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1190866278 X:54387389-54387411 AGGCGAGGCGAGAGAGGCCAAGG - Intergenic
1192491060 X:71578000-71578022 GGGCGCGGGGGGAGGGGCGGGGG - Intergenic
1193855659 X:86598944-86598966 TGGGGTGGCGGGAGGGGCGAGGG - Intronic
1194185092 X:90765653-90765675 AGGTGGGGAGGGAGAGGCGTGGG + Intergenic
1194204430 X:90995413-90995435 AGGTGCGGAGGGAGAGGTGCGGG + Intergenic
1194294619 X:92113169-92113191 AGGAGCAGCAGGAGAGGGGAAGG - Intronic
1194890522 X:99372406-99372428 AGGCGTGGAGGGAGAGGCGCGGG - Intergenic
1195909642 X:109876228-109876250 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1196041631 X:111211161-111211183 TGGCGGGGCGGGAGAGGAGTTGG + Intronic
1197533814 X:127663340-127663362 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1197607879 X:128606595-128606617 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1197978716 X:132194085-132194107 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1198256097 X:134925658-134925680 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1198388093 X:136147542-136147564 AGGCGCGGCGGTGGCGGCGGCGG - Exonic
1198872339 X:141188869-141188891 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1199094879 X:143726587-143726609 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1199556465 X:149114271-149114293 AGGTGTGGAGGGAGAGGCGTGGG - Intergenic
1199628071 X:149758559-149758581 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1199745194 X:150768077-150768099 GGGGGCGGCGGGGGAGGAGAGGG - Exonic
1200531716 Y:4347764-4347786 AGGTGGGGAGGGAGAGGCGTGGG + Intergenic
1200550271 Y:4570854-4570876 AGGTGCGGAGGGAGAGGTGCGGG + Intergenic
1201885742 Y:18880164-18880186 AGGTGTGGAGGGAGAGGCGTGGG + Intergenic