ID: 1010083579

View in Genome Browser
Species Human (GRCh38)
Location 6:71889230-71889252
Sequence GGAGAGTGAGGGATTTTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010083574_1010083579 5 Left 1010083574 6:71889202-71889224 CCTCTTCATTGGCTGTCTCAAGC 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1010083579 6:71889230-71889252 GGAGAGTGAGGGATTTTAAGTGG 0: 1
1: 0
2: 3
3: 16
4: 287
1010083573_1010083579 13 Left 1010083573 6:71889194-71889216 CCATCATGCCTCTTCATTGGCTG 0: 1
1: 0
2: 0
3: 19
4: 226
Right 1010083579 6:71889230-71889252 GGAGAGTGAGGGATTTTAAGTGG 0: 1
1: 0
2: 3
3: 16
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010083579 Original CRISPR GGAGAGTGAGGGATTTTAAG TGG Intronic
900757805 1:4449367-4449389 GGTGGGTGAGGGATGTTAAGTGG - Intergenic
900912353 1:5609212-5609234 AGACAGTGAGTAATTTTAAGTGG - Intergenic
901884795 1:12215292-12215314 GGAGAGAGATGGATTAGAAGCGG + Intergenic
902539701 1:17145485-17145507 GGAGCGTGCGGGACTGTAAGCGG - Intergenic
902689084 1:18098520-18098542 AGCCAGTGAAGGATTTTAAGGGG + Intergenic
903630040 1:24761533-24761555 GTAGAGTGAGGGATTGACAGGGG + Intronic
905871792 1:41408575-41408597 GGAGAAAGAGGCATTTGAAGGGG - Intergenic
907340442 1:53731509-53731531 GGAGAGTGGTGTATTTTCAGAGG + Intronic
907824361 1:58001066-58001088 GGAGAGGAAGGGATTATGAGGGG - Intronic
908142320 1:61198989-61199011 GGAGAGTGATGATTTTTTAGTGG - Intronic
909925010 1:81428615-81428637 GAAGAGTAAAGGATTTTTAGGGG + Intronic
910051791 1:82983082-82983104 GTAGAGTGAGAAATCTTAAGAGG + Intergenic
910258637 1:85275413-85275435 GAAGAGGAAGGGATTTGAAGTGG + Intronic
913971499 1:143421153-143421175 GCAGAGTGAGGGCCTTTATGGGG - Intergenic
914006053 1:143733404-143733426 AGTGAGGGAGGGGTTTTAAGGGG - Intergenic
914065876 1:144246766-144246788 GCAGAGTGAGGGCCTTTATGGGG - Intergenic
914098531 1:144564640-144564662 AGCGAGGGAGGGGTTTTAAGGGG - Intergenic
914113275 1:144719588-144719610 GCAGAGTGAGGGCCTTTATGGGG + Intergenic
914300453 1:146373003-146373025 AGTGAGGGAGGGGTTTTAAGGGG + Intergenic
914518227 1:148392425-148392447 AGTGAGGGAGGGGTTTTAAGGGG - Intergenic
914782375 1:150797379-150797401 AGCCAGTGAGGGATTTTGAGTGG + Intronic
917116702 1:171610673-171610695 TGAGAGGTAGGGACTTTAAGAGG - Intergenic
918373314 1:183882960-183882982 GGAGTGTGAGGGGTGTGAAGGGG + Intronic
918652686 1:186985200-186985222 GGACAGGCAGGGTTTTTAAGTGG - Intronic
918754081 1:188313911-188313933 AGTGAGTGAGGGAATTTAACGGG - Intergenic
919657943 1:200215357-200215379 GGAAAGGTAGGGACTTTAAGAGG + Intergenic
921191087 1:212709257-212709279 GGAGAGGGAGGGAGCATAAGAGG - Intergenic
924866123 1:247983143-247983165 TGAGATTCAGAGATTTTAAGTGG - Intronic
1062863359 10:827998-828020 GGACAGGGAGAGATTTTCAGAGG - Intronic
1065187523 10:23183348-23183370 GGAGAGTGAGGGAGTTAGAGGGG + Intergenic
1065645160 10:27826473-27826495 TGAGAGTGAGGGAACTGAAGTGG - Intronic
1066185097 10:33002770-33002792 GGAGACTGTGGGACTATAAGGGG + Intronic
1066591875 10:37004180-37004202 TGAGAGGTAGGGCTTTTAAGAGG - Intergenic
1068988695 10:63129999-63130021 GGAGGCAGAAGGATTTTAAGAGG + Intergenic
1069280417 10:66648341-66648363 GGTGAATGAGTGTTTTTAAGAGG + Intronic
1069775039 10:70921893-70921915 ACAGGGTGAGGGATTTTGAGAGG - Intergenic
1070028413 10:72653936-72653958 GTAGAGTGAGTTATCTTAAGAGG - Intergenic
1073289498 10:102406335-102406357 GGACAGTGAGGGAGTCTCAGTGG + Intronic
1073477591 10:103764368-103764390 GGAGAGTGAGTGAGCTGAAGAGG + Intronic
1073849157 10:107594296-107594318 TGTGAGTGACGGATTCTAAGAGG + Intergenic
1073969865 10:109035233-109035255 GGAGGGTAAAGGAATTTAAGAGG + Intergenic
1075879848 10:125841587-125841609 TGATAGTGAGGTATTTTAATAGG - Intronic
1077792808 11:5460238-5460260 GGAGGGTGAAGGATGTGAAGAGG + Intronic
1078470215 11:11580449-11580471 CGGAAGGGAGGGATTTTAAGTGG - Intronic
1079392341 11:20033584-20033606 GGAGAGTGAGGGCTCAAAAGGGG - Intronic
1080008809 11:27436923-27436945 GGAGATGGAGGGATTTGAGGGGG + Intronic
1080516056 11:33021310-33021332 AGATAGTGATGGATTTTAAAAGG + Intronic
1080613271 11:33923806-33923828 CCAGAGTGAGGGATTATAAAGGG - Intergenic
1081566160 11:44262568-44262590 GGAGAGTGAGAGCTTTAAGGGGG - Exonic
1085586003 11:77706636-77706658 GGAAAGTGAGGAATCTTAAAAGG - Intronic
1086353230 11:85965113-85965135 TGAGAGTTAGGACTTTTAAGAGG + Intronic
1086898158 11:92337065-92337087 CTAGAGTCAGGGATGTTAAGAGG - Intergenic
1086974784 11:93119338-93119360 GGAGAGTGAGAGATTTTTTAGGG + Intergenic
1087236572 11:95725313-95725335 GGAGAGAGAGGCATATTTAGAGG - Intergenic
1088590726 11:111400392-111400414 GGAGAGAGATGGATTTTCATTGG - Intronic
1090820910 11:130340741-130340763 GGAGAGTAAGGATTTTTAAAAGG + Intergenic
1091632174 12:2170601-2170623 GAAGAGTGAGGGAGTTGAGGTGG + Intronic
1092175984 12:6407322-6407344 GGATAGACAGAGATTTTAAGTGG - Intergenic
1094042577 12:26133294-26133316 GGGGAGTGAGGGAGATGAAGGGG - Intronic
1094398380 12:30033687-30033709 GGATAGTGAGGGAATTGCAGAGG + Intergenic
1094556854 12:31509380-31509402 GGAGGCTGAGGCATTCTAAGGGG + Intronic
1095208262 12:39462955-39462977 GGAGAGTGAGGGAGAATGAGAGG - Intergenic
1095915465 12:47473859-47473881 TGAGATTAAGGGAGTTTAAGAGG + Intergenic
1096778199 12:53976457-53976479 GGAGCATGGAGGATTTTAAGAGG - Exonic
1097220424 12:57447061-57447083 GGAAGGTGAGGGATGATAAGAGG + Intronic
1097521817 12:60679723-60679745 GGAGAGTGATGGAGTGTAACAGG - Intergenic
1098725195 12:73956003-73956025 GGAGAAAGAGGGATTTGAAAGGG - Intergenic
1099509257 12:83513062-83513084 GGATGGTGAGGGAGGTTAAGTGG + Intergenic
1099762668 12:86941470-86941492 CCAGAGTTGGGGATTTTAAGAGG - Intergenic
1100543390 12:95579059-95579081 AGCTAGTGAGGGATTTTAAGTGG + Intergenic
1100563553 12:95772958-95772980 GGAGATTTTGAGATTTTAAGTGG - Intronic
1100622084 12:96286961-96286983 GGAGAGTTGGACATTTTAAGTGG - Intronic
1101243635 12:102863485-102863507 GGAGAATGAGGGATTTCAATTGG - Intronic
1103160387 12:118724468-118724490 GGAGACTGAGTGATTTTCTGAGG - Intergenic
1103160534 12:118725505-118725527 GGAGATTGAGTGATTTTCTGAGG + Intergenic
1103684527 12:122721409-122721431 GGTGAGTGATAAATTTTAAGTGG - Intergenic
1105421287 13:20254671-20254693 GGTAAGAGAGGGATTTTACGTGG + Intergenic
1107300463 13:38960804-38960826 GGGGAGGGGGGGACTTTAAGAGG - Intergenic
1107726928 13:43308259-43308281 TGAGAGGGAGGTAGTTTAAGTGG - Intronic
1108179848 13:47829642-47829664 GGAGAGTGAGTCATTTTTGGGGG - Intergenic
1108260779 13:48653655-48653677 TTAGAGTCAGGAATTTTAAGTGG - Intergenic
1108890032 13:55245382-55245404 AGAGAATGAGGGATTTTACCTGG + Intergenic
1109856217 13:68131372-68131394 GGGGAGTGAGGCATCTTAAGTGG + Intergenic
1110300508 13:73921106-73921128 GAAGAGTGAATGATTTTTAGGGG - Intronic
1110354238 13:74548354-74548376 TGAGAGGTAGGGACTTTAAGAGG + Intergenic
1110354312 13:74549622-74549644 TGAGAGGTAGGGACTTTAAGAGG + Intergenic
1112719334 13:102225186-102225208 GGAGAGAGAGGGATTGAAAGAGG - Intronic
1112962628 13:105145464-105145486 GGAGAGTAAAGGGCTTTAAGGGG + Intergenic
1113160478 13:107374788-107374810 AGAGAGTGAGAGAGTTCAAGAGG - Intronic
1113357068 13:109591030-109591052 GGACACGGAGGAATTTTAAGGGG + Intergenic
1113386715 13:109855525-109855547 GGAGTGGGTGGGATTTCAAGAGG + Intergenic
1113548698 13:111175352-111175374 GGAGAGTGAGGGAATGGGAGAGG + Intronic
1116134708 14:40907698-40907720 AGAGAGAGAGAGATTTTAAATGG - Intergenic
1116441056 14:44953405-44953427 TGAGAGGTAGGGCTTTTAAGAGG + Intronic
1116702757 14:48261264-48261286 GCAGAGTGAAATATTTTAAGTGG + Intergenic
1117017081 14:51528874-51528896 GGAAACTGGGGGATGTTAAGGGG - Intronic
1117068355 14:52033188-52033210 AGAGAGTCAGGCAGTTTAAGAGG - Intronic
1117169417 14:53077307-53077329 GAAGAGTGATGGAATTTAAAAGG - Intronic
1118850043 14:69576172-69576194 AGAAAGTGAAGGGTTTTAAGTGG + Intergenic
1119775832 14:77248282-77248304 GGAGAGGGAGAGATGTTAAAAGG - Intronic
1119931334 14:78550443-78550465 TGAGTGTGAGTGATTTTAGGAGG - Intronic
1121348865 14:93156964-93156986 GAAGAGGGAGGGACTTTGAGAGG + Intergenic
1122014530 14:98783085-98783107 GGAGAGTGAGAGAATTGGAGAGG - Intergenic
1123584091 15:21741871-21741893 TTGGAGTGAGGGATTTTAAGAGG - Intergenic
1123620741 15:22184474-22184496 TTGGAGTGAGGGATTTTAAGAGG - Intergenic
1128422392 15:67506087-67506109 GGAGAATGAGGGAATAGAAGAGG + Intergenic
1131197967 15:90372129-90372151 GGAGAGGGAGGTGTTTTAATGGG - Intergenic
1131915150 15:97257124-97257146 GGAGGGAAGGGGATTTTAAGCGG + Intergenic
1132163550 15:99565091-99565113 GGAGAGAAAGGGACTTGAAGGGG - Intergenic
1132376661 15:101332577-101332599 GGACAGTGAGGGATGTTCTGGGG + Intronic
1134004381 16:10808351-10808373 GGCTAGTTAGGGATTTTCAGGGG + Intronic
1136995166 16:35184065-35184087 GGAGAGTGAGGGATCAGAACAGG + Intergenic
1137809242 16:51337129-51337151 CCAGGGTGAGTGATTTTAAGGGG - Intergenic
1139025422 16:62811352-62811374 GGAAACTGAGGGATTTTCATTGG + Intergenic
1139220292 16:65174974-65174996 AGAAAGTGAGGGATTCAAAGGGG + Intergenic
1139286270 16:65817179-65817201 TGAGAGGTAGGGATTCTAAGGGG + Intergenic
1140253108 16:73312050-73312072 GGTGTGTGACGTATTTTAAGGGG + Intergenic
1140292992 16:73681222-73681244 GGAGAGAAAGGCATTTTAATAGG + Intergenic
1143200854 17:5112104-5112126 GGAGAGTGAGCCCTTGTAAGCGG + Exonic
1143767687 17:9148410-9148432 GGAGACTGAGGAAATTAAAGTGG + Intronic
1144993204 17:19248086-19248108 GGAGTGTCAGGGATTGGAAGGGG + Intronic
1146604782 17:34248987-34249009 GCAGAGAGAGTGATTTTCAGGGG - Intergenic
1147284708 17:39392629-39392651 GCAGAGTGAGGAATTATATGTGG - Intronic
1148172357 17:45533060-45533082 GGAGAGTGAGAGAATTTTGGAGG - Intergenic
1148276910 17:46312392-46312414 GGAGAGTGAGAGAATTTTGGAGG + Intronic
1148299026 17:46529976-46529998 GGAGAGTGAGAGAATTTTGGAGG + Intronic
1148363566 17:47034503-47034525 GGAGAGTGAGAGAATTTTGGAGG + Intronic
1149643825 17:58224332-58224354 GCAGTGTGAGGGAATTTTAGGGG + Intronic
1150403563 17:64879976-64879998 GGAGAGTGAGAGAATTTTGGAGG - Intronic
1150759394 17:67947081-67947103 GGAAAGAGAAGGGTTTTAAGAGG - Intronic
1153953078 18:10073304-10073326 GAAGATTAAGGGAATTTAAGTGG + Intergenic
1157688959 18:49665201-49665223 TGAGAGGCAGGGCTTTTAAGAGG + Intergenic
1157943328 18:51953136-51953158 GTGGAGAGAGGGATTTTAAAAGG - Intergenic
1161057537 19:2198245-2198267 GGGGAATGAGGGATGTTCAGAGG + Intronic
1164424127 19:28125147-28125169 GAAGAATGAGAGATTTTGAGGGG - Intergenic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
1167874307 19:52398619-52398641 GGTGAGTGAGGGGTTTGCAGAGG + Exonic
926558948 2:14394062-14394084 GGAGAGACAGGGTTATTAAGTGG + Intergenic
929060708 2:37922049-37922071 TGAGAGAGAGGGATTTAGAGAGG - Intergenic
929404880 2:41630196-41630218 GAAGAGTCAGGGAGTGTAAGTGG + Intergenic
929591760 2:43152539-43152561 AGAGAGTGAGGGAGTGTCAGAGG + Intergenic
929595785 2:43174774-43174796 GGACAGTGAGGGATTTGCTGGGG - Intergenic
930519924 2:52452776-52452798 GGTGAGTGAGGGACTGTGAGGGG - Intergenic
931146691 2:59527136-59527158 GGTGGGTGAGGTGTTTTAAGAGG - Intergenic
934176193 2:89582086-89582108 GCAGAGTGAGGGCCTTTATGGGG - Intergenic
934286503 2:91656447-91656469 GCAGAGTGAGGGCCTTTATGGGG - Intergenic
934493791 2:94780589-94780611 GGAGAGTGGAGGGTATTAAGGGG - Intergenic
934583931 2:95472049-95472071 GGAGGGTGGGGGATTAGAAGAGG + Intergenic
934595521 2:95604665-95604687 GGAGGGTGGGGGATTAGAAGAGG - Intergenic
935189179 2:100762190-100762212 GGAGAGAGATGCATTTTGAGAGG - Intergenic
936248724 2:110851128-110851150 GCAAAGTGAGGGATTTTTGGGGG + Intronic
937062074 2:118988212-118988234 GGAGAGTGTGGGAAATGAAGAGG + Intronic
937696790 2:124817255-124817277 GGAGAATGAGGGAATGCAAGGGG + Intronic
937737366 2:125308477-125308499 AGAGAGAGAGAGATTTGAAGAGG - Intergenic
937955932 2:127421844-127421866 ACAGAGTGAGCGATTTTATGTGG - Intronic
939019132 2:136938221-136938243 GCAGATTGTGAGATTTTAAGGGG + Intronic
940364298 2:152829673-152829695 GGAAAGGATGGGATTTTAAGTGG + Intergenic
941262654 2:163317200-163317222 AGAGAGTGAGAGAATGTAAGAGG - Intergenic
942265230 2:174217674-174217696 GCAGAGAGAGGGATTATAAAGGG - Intronic
944045830 2:195410880-195410902 GTAGAATGAGAGAATTTAAGAGG + Intergenic
946032731 2:216717867-216717889 GGAAATTCTGGGATTTTAAGAGG - Intergenic
1169759606 20:9076677-9076699 GGAAAATGAGGGCTGTTAAGCGG - Intronic
1170550893 20:17475073-17475095 GGAGAGTGAGGGATTTGGGAGGG + Intronic
1170730598 20:18971696-18971718 GGTAAGTGAGTAATTTTAAGGGG + Intergenic
1171540616 20:25951011-25951033 GGAAATTGAGGGAATTTATGGGG - Intergenic
1171800459 20:29609328-29609350 GGAAATTGAGGGAATTTATGGGG + Intergenic
1171843642 20:30247380-30247402 GGAAATTGAGGGAATTTATGGGG - Intergenic
1171997813 20:31746103-31746125 GGACAGTGAGGGATTGTCATTGG + Intronic
1172318902 20:33980603-33980625 GCAGAAGGAGGGATGTTAAGGGG + Intergenic
1174945958 20:54985319-54985341 GGTGAGTTAGGGACTTTGAGAGG + Intergenic
1175051263 20:56157545-56157567 GGTGAGCGAGCGTTTTTAAGAGG + Intergenic
1177665822 21:24157987-24158009 GTAGAGTGAGGCTCTTTAAGTGG - Intergenic
1179041065 21:37802497-37802519 GGAGAGAGAGAGATTGGAAGAGG + Intronic
1179159689 21:38884078-38884100 GGATAGTAAGTGATTTTCAGGGG - Intergenic
1179497891 21:41785757-41785779 GGAAAGTGAGGCTTTTTAAAAGG + Intergenic
1182253641 22:29021978-29022000 AGGGAGGGAGGGATTTTAAAGGG - Intronic
1182675089 22:32032729-32032751 GGAGTGTGAGGAAGTTTAACGGG - Intergenic
1183265690 22:36823896-36823918 GGAGAGTCAGCGGTTTTCAGAGG - Intergenic
1184928789 22:47664155-47664177 GGAGAGTGAGGCTTTGTATGGGG + Intergenic
949427404 3:3933630-3933652 GGGGAGTGAAATATTTTAAGTGG + Intronic
951143063 3:19190817-19190839 CGTGTTTGAGGGATTTTAAGTGG - Intronic
952544611 3:34405460-34405482 GTAGAGTGAGGGATAATAATAGG + Intergenic
952689004 3:36181788-36181810 GGGGAGTGAGGCATCTTACGTGG + Intergenic
953720983 3:45355019-45355041 GGAGAGAGAGAGATTATTAGAGG + Intergenic
954161689 3:48727366-48727388 CCAGAGTGGGGGAGTTTAAGGGG + Intronic
955310290 3:57880002-57880024 GGAGAGGAAGGGATTTTTATTGG + Intronic
955340130 3:58118785-58118807 GAAGAATGAGGGATCTTGAGGGG + Intronic
955889058 3:63631378-63631400 GGAGATTGAGGGAGAATAAGGGG - Intergenic
957037088 3:75303575-75303597 GGAGAGGGGGGGATTATAAATGG - Intergenic
959517155 3:107281363-107281385 AGAGCATGAGGGATTTTGAGGGG + Intergenic
959957813 3:112258909-112258931 GGAGAGAGAGGGAGTCAAAGGGG + Intronic
960231656 3:115235107-115235129 GAAGAGGGAAGGATTTTAGGAGG + Intergenic
960398378 3:117165652-117165674 GGAGACTGAGGGCTTTGAATGGG + Intergenic
960409032 3:117299189-117299211 GGAGTGTTAGGAATTTGAAGAGG - Intergenic
960522621 3:118673090-118673112 GGAGTTTGAGGGATTTTAAGTGG - Intergenic
960936499 3:122907288-122907310 AGAGACTTAGGGATTTTAAATGG - Intergenic
962489880 3:135883011-135883033 GGAGAGTCAGTGAAATTAAGTGG - Intergenic
964739255 3:159948450-159948472 TGAGAGGTAGGGCTTTTAAGAGG + Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
967330938 3:188288780-188288802 AGAGAGAGATTGATTTTAAGAGG - Intronic
970339353 4:15088212-15088234 GGATAGTGAGGTATTTGCAGAGG - Intergenic
970638231 4:18033970-18033992 GGAAAGGGAAGGTTTTTAAGAGG - Intergenic
971446213 4:26752060-26752082 AGAGAGTGAGGCATAGTAAGTGG - Intronic
971608064 4:28684383-28684405 GGAGAGTGACAGATTTGGAGAGG - Intergenic
971936324 4:33152599-33152621 GGAAAGTGTGGGGTTTCAAGAGG + Intergenic
974328864 4:60450653-60450675 GGAGTGAGAGGTAATTTAAGAGG - Intergenic
974777718 4:66508312-66508334 GGAGACTGAGGGGTTTAGAGTGG + Intergenic
977085880 4:92598429-92598451 GGAGAGTCAAGGATTAAAAGGGG - Intronic
977689768 4:99893903-99893925 GGAGAGTGGGGAATTTTGAGGGG - Intronic
978111098 4:104964539-104964561 GGTGAGTGAGAGATTTTCAGTGG - Intergenic
979097464 4:116569046-116569068 GGAGAGTGAGGGATGAGAAGAGG + Intergenic
979986947 4:127327072-127327094 GGAGAGAGAGGGAAAGTAAGGGG - Intergenic
981248862 4:142574350-142574372 AGGGAGTGAGGGATTTTAATTGG - Intronic
982386067 4:154803778-154803800 GGATAGTGAGTGAGTTTAATGGG + Intronic
983555331 4:169054510-169054532 GGAGGGTGATGGATTCTATGGGG - Intergenic
984116174 4:175683658-175683680 GGAGAGAGAGAGAGTTAAAGGGG - Intronic
986047297 5:4051727-4051749 GCCCAGTGAGAGATTTTAAGTGG - Intergenic
986573375 5:9188549-9188571 GGAGTGGGAGGGATTTTGATGGG - Intronic
987279967 5:16403135-16403157 GGAGAGTGAGGCATCTTACGTGG + Intergenic
989045356 5:37268692-37268714 GTAGGGTGAGGGCTATTAAGCGG - Intergenic
989313870 5:40054086-40054108 AGAAAGTCAGGAATTTTAAGTGG - Intergenic
989470868 5:41816717-41816739 GGAGAGATAGTGATCTTAAGGGG - Intronic
990617829 5:57525272-57525294 GGAGGGTTAGGGAGTTTGAGAGG + Intergenic
990772511 5:59265067-59265089 GAAGAGTAAGGGATTTGTAGAGG + Intronic
994377874 5:99035905-99035927 GGGGAGTGAGGGATGAAAAGTGG - Intergenic
995395591 5:111683175-111683197 GGAGAGAATGGGAATTTAAGAGG + Intronic
995531359 5:113094981-113095003 GTAGACTGAGGGAGTTTTAGGGG - Intronic
996426760 5:123321121-123321143 GGAGAGTGAGGCATCTGGAGAGG - Intergenic
997872385 5:137517034-137517056 GGAGAGTCAGGGATGATGAGAGG + Intronic
998631921 5:143908247-143908269 GCAGACTGAGGGACTTTTAGTGG + Intergenic
1000243431 5:159429419-159429441 GGGGAGTGAGGTATTTCATGGGG + Intergenic
1000666666 5:164006301-164006323 GTAGAGTGGGGGCTTTTAATGGG + Intergenic
1001541485 5:172542845-172542867 GGAGAGTGAGGAAATCCAAGAGG - Intergenic
1003166810 6:3686665-3686687 GGAGAGGGTGAGATTATAAGGGG - Intergenic
1003871719 6:10409742-10409764 GGAGAGTGAGGGACGTTTTGAGG - Intronic
1003933717 6:10954222-10954244 GGGGAGAGAGTGGTTTTAAGTGG + Intronic
1004627455 6:17390223-17390245 GGAGAGTGAGGCATCTTAAGTGG - Intergenic
1005220239 6:23578431-23578453 TGAGAGTGAGGGATTTCTATTGG - Intergenic
1006935385 6:37713662-37713684 GGACACAGAGGGATTTTCAGTGG - Intergenic
1007912588 6:45530728-45530750 AGAGAGTGAGGGAATTAAAAAGG + Intronic
1008329920 6:50232480-50232502 TGGGAGTGAGGTATTTAAAGAGG - Intergenic
1009910673 6:69923275-69923297 GGAGAGAGAGGGATATGAATAGG - Intronic
1010083579 6:71889230-71889252 GGAGAGTGAGGGATTTTAAGTGG + Intronic
1010392045 6:75349099-75349121 GTAGAATGAGGGATTTGAAAGGG + Intronic
1010683850 6:78828758-78828780 GAAGAGTGGGGGCTTTTCAGAGG + Intergenic
1010721888 6:79292096-79292118 GGAATGTGGGTGATTTTAAGAGG + Intergenic
1010799053 6:80152904-80152926 GTAGAGTGAGGGCTTTTAAGTGG + Intronic
1010935281 6:81852867-81852889 AGACAGTTAGGGATTCTAAGAGG - Intergenic
1011758361 6:90529210-90529232 GGGGCATGAGGAATTTTAAGAGG - Intronic
1012894053 6:104928750-104928772 GGAGACTAAGGGATTTGGAGAGG - Intergenic
1012952792 6:105536824-105536846 GGAGTGAGAAGGATTTGAAGAGG + Intergenic
1018149373 6:160924254-160924276 GGAGACGGAGGGATTTTAGGGGG - Intergenic
1018476608 6:164148742-164148764 GGAGAGAGAGGGATTTTCTTTGG + Intergenic
1022036283 7:26537755-26537777 GGTGAGTGAGGGATGATAACAGG + Intronic
1022967255 7:35485403-35485425 GGAGAGTGAGGCAATTCCAGGGG - Intergenic
1023859155 7:44206798-44206820 GGAGAGTGAAGGCATTCAAGAGG - Intronic
1025292044 7:57737252-57737274 GGAAATTGAGGGAATTTATGGGG - Intergenic
1027715098 7:81659659-81659681 GGAGGGTGAGGGATTTGCACTGG - Intergenic
1028865851 7:95710681-95710703 TGAGAGTGATGGATTTTGGGGGG + Intergenic
1030031972 7:105377895-105377917 GGAGACTGATGTATATTAAGGGG - Intronic
1031070518 7:117156397-117156419 GGAGAGGGACGGGTTTTAAATGG + Intronic
1031631243 7:124045651-124045673 TGAGAGTGAGGGATGGTGAGAGG - Intergenic
1031781568 7:125974457-125974479 AGAGAGAGAGAGAGTTTAAGAGG + Intergenic
1035762596 8:2080596-2080618 TGAAAGTGAGGGATTTGAGGAGG + Intronic
1036535012 8:9640357-9640379 TGAGAGGGAGGAACTTTAAGAGG - Intronic
1037098253 8:15012065-15012087 GGACAAAGATGGATTTTAAGAGG - Intronic
1037268297 8:17093999-17094021 GGACATTGAGGGATTATGAGTGG - Intronic
1037793337 8:21967766-21967788 GGAGATTGTAGGATTTTAAATGG + Intronic
1038740199 8:30210596-30210618 GGAGAGTTTGGGATTTGAGGAGG + Intergenic
1038941236 8:32308169-32308191 GGAGAATAAGGGAATCTAAGTGG - Intronic
1039766838 8:40637519-40637541 AGAGAGAGAGGGAGATTAAGGGG + Intronic
1039969229 8:42307386-42307408 AGAGATTGATGGGTTTTAAGTGG + Intronic
1041958009 8:63577757-63577779 GGACAGTGAGGGAGTTTCAAGGG + Intergenic
1043387054 8:79758862-79758884 GGAGAGTGGGGGCTTTTGTGGGG + Intergenic
1044114930 8:88324368-88324390 GGGAAGTGGGGGATTTGAAGAGG - Intronic
1044820225 8:96151025-96151047 GGAGTGTGAAGGGCTTTAAGGGG + Intronic
1045476058 8:102553704-102553726 GGACAGAGAGGGATTTTAATTGG - Intronic
1045518114 8:102878974-102878996 TGAGAGGTAGGGACTTTAAGAGG + Intronic
1047624778 8:126645496-126645518 GGAGAGGGAGGGAAATGAAGAGG - Intergenic
1052455620 9:28693428-28693450 TGAGATGCAGGGATTTTAAGAGG + Intergenic
1053139664 9:35674686-35674708 GGAGAGTCAGAGAGTTTGAGGGG + Intronic
1054164460 9:61708445-61708467 GGAAATTGAGGGAATTTATGGGG + Intergenic
1055427050 9:76207049-76207071 GTAGAGTGAGAGATTTAACGAGG - Intronic
1056928356 9:90853978-90854000 GGAGAGGGAGGGAAGTGAAGCGG + Intronic
1057488231 9:95503052-95503074 GGAAAGTATGAGATTTTAAGGGG - Intronic
1058758945 9:108110749-108110771 AGAGAGTGATGGATTTTAAAAGG - Intergenic
1059090888 9:111356704-111356726 GGAGAGAGGGTGATTTTCAGTGG - Intergenic
1059282948 9:113150380-113150402 GTAGGGTGAGGGATTTTTAATGG - Intergenic
1059574692 9:115476014-115476036 CGAGAGTTGGGGAGTTTAAGAGG - Intergenic
1059987912 9:119837880-119837902 GGAGAGTGATGGATATGAATGGG - Intergenic
1060421711 9:123473789-123473811 GGAGATTTAGGGACTTTTAGTGG - Intronic
1060533464 9:124363766-124363788 GGAGTTTTAGGGGTTTTAAGTGG + Intronic
1186892021 X:13968306-13968328 AGAGAGTGAGGGAGTGAAAGAGG + Intergenic
1187058735 X:15765622-15765644 GGGGAGTGAGGGATATGGAGGGG - Intronic
1189202763 X:39211926-39211948 GGAGAGTGAGGCATCTTACATGG + Intergenic
1190135617 X:47794762-47794784 TGAGAGGTAGGGCTTTTAAGAGG + Intergenic
1190143913 X:47873394-47873416 GCAGATTGAGGGAGTTTCAGGGG - Intronic
1190340829 X:49294210-49294232 GGAGAGGGAGTGACTCTAAGGGG - Intronic
1194135425 X:90134886-90134908 GGAAAGTGAGGGTTCTTAGGAGG + Intergenic
1195496793 X:105545500-105545522 GGAGAGGCAGGGGTTTTAAAAGG + Intronic
1195718579 X:107843148-107843170 GAAGAGTGGGGGATGTGAAGAGG + Intronic
1195819776 X:108931332-108931354 GGGGAGTGAGGGGTTGCAAGGGG - Intergenic
1196830609 X:119772778-119772800 GCAGAGTGAGGGAGGGTAAGTGG - Intergenic
1198339059 X:135696316-135696338 GGAAAGTGAGGGAATTTGATTGG + Intergenic
1198727081 X:139689535-139689557 GGAGAGAGAGAGATTTGGAGAGG - Intronic
1200354900 X:155538492-155538514 AGAGAGTGAGTGATTTTACTAGG - Intronic
1200481201 Y:3704993-3705015 GGAAAGTGAGGGTTCTTAGGAGG + Intergenic