ID: 1010087769

View in Genome Browser
Species Human (GRCh38)
Location 6:71940652-71940674
Sequence AGAAGGATTTTCAAGTGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010087769 Original CRISPR AGAAGGATTTTCAAGTGCTA GGG Intronic
900519359 1:3098229-3098251 AGAAGGATTTTCCAGACCCAGGG - Intronic
900999702 1:6142670-6142692 AGAAGGAATTGCATGTGCAAAGG - Intronic
901722609 1:11211886-11211908 AGAAGAAATAGCAAGTGCTAAGG - Intronic
904732388 1:32604537-32604559 AGAAGGAACATCATGTGCTAAGG - Exonic
904922406 1:34019321-34019343 AGATGAATGTTCAAGTGCTGGGG - Intronic
905476812 1:38234714-38234736 AGGAGCATTCTCAGGTGCTAAGG + Intergenic
906930542 1:50165243-50165265 AGAAGGAATCTCATGTGCAAAGG - Intronic
907356160 1:53875735-53875757 AGAAGGATCAGCAAGTGCAAAGG - Intronic
909370150 1:74874082-74874104 AAAAGGATTCCCATGTGCTAGGG + Intergenic
909685912 1:78348566-78348588 AGAAGGATATTGAAGTGATGTGG + Intronic
910248100 1:85164577-85164599 AGAAGAACTTGCAAGTGCTTTGG - Exonic
911426728 1:97724832-97724854 AGCAAGAATTTCAAGTGCTATGG - Intronic
911847982 1:102778777-102778799 AGAAGGATCTCCAAGTGCTCTGG - Intergenic
911983281 1:104592919-104592941 AGATGCATTTTCAGGTGGTATGG + Intergenic
912558678 1:110534736-110534758 AGGAGGATTTTTGAGTGCAATGG + Intergenic
913543574 1:119844637-119844659 TGAAGGATCTTAAAGTGCTGTGG - Intergenic
914995414 1:152539219-152539241 AGAAGGAGTTCCATGTGCTATGG + Intronic
919551381 1:198992961-198992983 ATCAGGATTTTCAAGGGCCATGG - Intergenic
920119119 1:203642528-203642550 AAATGGATTTTCCAGTGTTAAGG - Intronic
920289413 1:204907670-204907692 AGAAGGTTTTTGAAATGCAAGGG - Intronic
921392318 1:214629155-214629177 AAAAGGAGTTTCAAGAGGTAAGG + Exonic
921551711 1:216544663-216544685 AGAACGAGTTTCAAGAGCTGGGG + Intronic
921807153 1:219468455-219468477 AGCTTGATTTTCAAGTGCTGTGG - Intergenic
922386130 1:225085347-225085369 AGGATGATTTTAAAGTGCAAAGG + Intronic
1063023850 10:2157947-2157969 AGAAGCATTTTCACTTGTTATGG + Intergenic
1066478328 10:35770266-35770288 ACAAGGATTTTCAACTGTGAAGG - Intergenic
1067559508 10:47295108-47295130 AGTGGGATTGTCAAGTGCCATGG - Intergenic
1068295033 10:55059216-55059238 GGAAGGTTTTTAAAGTACTATGG - Intronic
1069361601 10:67649361-67649383 AGAAGGATTTACATATGATATGG - Intronic
1070374288 10:75814141-75814163 AGCAGGATCTTCAAGTTCAAGGG - Intronic
1071279531 10:84087449-84087471 ATAATGATTTACAAGTGCCATGG - Intergenic
1071577987 10:86743853-86743875 AGAAGGAAATTCCAGAGCTAAGG + Intergenic
1071833635 10:89396710-89396732 ACAAGTATTGACAAGTGCTATGG - Intronic
1071938418 10:90557355-90557377 ACAATAATTTTCAAGGGCTAGGG - Intergenic
1072563108 10:96595075-96595097 AGCAGGGTATTTAAGTGCTAGGG - Exonic
1073946571 10:108757505-108757527 AGAAGGGTTTTTAAGTGCTGGGG - Intergenic
1075525910 10:123186659-123186681 AGAAACACTTTCAAGTTCTAGGG - Intergenic
1076105301 10:127817717-127817739 AGAATGGTTGTCATGTGCTAAGG + Intergenic
1080281763 11:30565375-30565397 AGAAAGATTTTCATATACTAAGG + Intronic
1085880140 11:80457650-80457672 ATAAAGATTTACAAGTCCTATGG - Intergenic
1085952078 11:81344255-81344277 ATCAGGATTTTCATGTGCGAGGG + Intergenic
1089650033 11:119907032-119907054 AGAAGGATGTTCTAGGCCTAAGG + Intergenic
1090569157 11:128028686-128028708 AGAAGGATCATCAAGCTCTATGG - Intergenic
1092669360 12:10845551-10845573 AGAGGGAGTTGCAAGTGCTGGGG - Intronic
1093912290 12:24761883-24761905 AGAAAGATTTTCAACTAATACGG + Intergenic
1094593433 12:31842549-31842571 ACAAGAAATTTCAAGTGCTTAGG - Intergenic
1095330348 12:40954005-40954027 AGAAACATTTTAAATTGCTAAGG + Intronic
1096388542 12:51211806-51211828 AGAAGGAACAGCAAGTGCTAAGG + Intronic
1097389782 12:58995761-58995783 AGAAGGAATTTCAAATGATTTGG + Intergenic
1097637250 12:62137937-62137959 AGGAGGATTTTGAAGATCTAAGG - Intronic
1097744775 12:63289137-63289159 AAAATCATTTACAAGTGCTAAGG - Intergenic
1098498049 12:71159821-71159843 AAAAGAATTTTAAAGTGCTAAGG - Intronic
1098843394 12:75505285-75505307 ACAAGGATTTTAATGAGCTATGG + Intronic
1100310294 12:93388677-93388699 AAAAGCATTTTAAAGTGGTAAGG + Intronic
1100585271 12:95973600-95973622 ACAAGGAGTTTCATGTGCAAAGG - Exonic
1100722361 12:97372430-97372452 AGCATGATGTTCAAGAGCTAAGG + Intergenic
1104614115 12:130254296-130254318 GGAAGGATTTTCAATTTCAATGG + Intergenic
1105353537 13:19637201-19637223 AGAACAATTTTCAAGTATTAAGG - Intronic
1106468590 13:30034806-30034828 AGAAGGATTTTCAATAACAAGGG + Intergenic
1107534775 13:41317812-41317834 AGAATGATTTTCAAACTCTATGG - Intronic
1107898300 13:44987998-44988020 AGAAGGAACTGCAAGTGCAAAGG - Intronic
1108009800 13:45994330-45994352 ACAAGGATTTTCAACTGCACAGG + Intronic
1109428631 13:62201030-62201052 AGAAAAGTTTTCAAGTGCAAAGG - Intergenic
1109984457 13:69959882-69959904 GGGAGGATTTTTAAGTGCCAAGG - Intronic
1110288245 13:73774712-73774734 AAAATAATTTTCAAGTGCCAGGG + Intronic
1110422057 13:75322415-75322437 AGAAGGATTTTGAAGTCAAAGGG - Intronic
1111505244 13:89180895-89180917 TAAAGTTTTTTCAAGTGCTATGG + Intergenic
1112134763 13:96564930-96564952 AGAAGAAATTAGAAGTGCTATGG + Intronic
1115393714 14:32882878-32882900 AGTAGGATTTCCTAGTGATATGG + Intergenic
1115819026 14:37194182-37194204 AGAATGAGTTTGAATTGCTAGGG - Intergenic
1116575701 14:46572437-46572459 AGAAGAATTTTCAGGTGGAAGGG + Intergenic
1116859928 14:49986576-49986598 TGAAGGGTGTTGAAGTGCTAAGG - Intronic
1117683920 14:58233623-58233645 ACATGGATTTTCAACTGCTTGGG + Intronic
1118202306 14:63687648-63687670 AGAGGGAATATCAAGTGCAAAGG + Intronic
1118710234 14:68512949-68512971 AGAAGGAATAGCAAGTGCAAAGG + Intronic
1118749876 14:68797621-68797643 AGAAGCATTTGCATGTGCAAAGG - Intergenic
1118844660 14:69538324-69538346 TGAATGAATTTCAAGTGTTAGGG - Intergenic
1119664750 14:76477345-76477367 AGATGAATGTTGAAGTGCTATGG + Intronic
1120308986 14:82806392-82806414 AGGAGAATTTTAAAATGCTAGGG + Intergenic
1120440369 14:84529388-84529410 ACAAGGATTTTCAACTGATAGGG + Intergenic
1121392925 14:93591341-93591363 ACAAGGATTTTCAACTGCACAGG - Intronic
1121852871 14:97238178-97238200 AAAAGGATTTTCATCTGCTTTGG + Intergenic
1122049797 14:99048580-99048602 AGGAGGATTAGCAAGTGCAAAGG + Intergenic
1123131754 14:105992517-105992539 AGGAGGAATTACAAGTCCTACGG + Intergenic
1125408378 15:39378590-39378612 AGTTGGATTTTCAGGTCCTAGGG - Intergenic
1126964145 15:54032025-54032047 AGAAGGATTTTCTTGTCTTATGG + Intronic
1128011146 15:64297379-64297401 AGAAGGAATTGCAAGTGTAAAGG + Intronic
1130939421 15:88495320-88495342 AGAAAGAGGTTCAAATGCTATGG + Intergenic
1131345459 15:91643703-91643725 AGAAGGGATATCAAGTGCTGAGG - Intergenic
1131641625 15:94299429-94299451 AGAAGGAAGTTCAAATCCTAAGG - Intronic
1131957528 15:97752344-97752366 AAAAGGATTTCCAAGTTCTTGGG - Intergenic
1136015740 16:27399645-27399667 AGAAGGATCTGCAAGTGCAAAGG - Intergenic
1136106389 16:28033164-28033186 AGAAGGATTGGCAGGTGCAAAGG - Intronic
1138743793 16:59339896-59339918 AGGAGGATTTTTAAGGGCTTTGG + Intergenic
1138971522 16:62150092-62150114 TGAAAGATGTTCAAGAGCTAAGG - Intergenic
1139084928 16:63573150-63573172 AGAAGTATTTACAGGTACTATGG + Intergenic
1139180238 16:64738600-64738622 AGAAGCATGTTCCTGTGCTAGGG + Intergenic
1140034605 16:71362823-71362845 TGTAAAATTTTCAAGTGCTATGG - Intronic
1142317057 16:89354291-89354313 AGGAGGCTTTTCAAATTCTAGGG - Intronic
1146549427 17:33767713-33767735 TGAAGGATTTTAAAATTCTAAGG + Intronic
1150200254 17:63348407-63348429 ATAAGGATTTTAAAGGGCTTGGG + Intronic
1150434049 17:65140417-65140439 GGATGGATTTTGAAGTGCAAGGG + Intronic
1151134588 17:71933826-71933848 AGAAGGATTTCAAAGAGCTGTGG + Intergenic
1153404591 18:4722495-4722517 ATAAGGATCTTCCAGAGCTAAGG + Intergenic
1155025087 18:21934050-21934072 AGGAGGATTTGCATGTGCTTTGG + Intergenic
1155153111 18:23137136-23137158 AGAAGGACTTTCCATTGCTCAGG - Intronic
1155452802 18:25980551-25980573 AGAAGGATTGACAAGTGGAAAGG - Intergenic
1155850168 18:30764378-30764400 TGAAGGGTTTTTAAGTGCTGTGG - Intergenic
1157698791 18:49746191-49746213 AGAAGGATTTTGCCGTGTTATGG + Intergenic
1158484169 18:57850155-57850177 AGATGGATTTAGAAGTGCAATGG + Intergenic
1158769527 18:60498370-60498392 AGGAGGATTTTTAAATGCTGGGG + Intergenic
1159142840 18:64418338-64418360 AAAAGGAGTTTCAAGAGCGATGG - Intergenic
925542487 2:4980676-4980698 AGAAGGGTTATCAACTGATAAGG + Intergenic
925615219 2:5738949-5738971 AGAAAGATTTTCAACTGCCAAGG - Intergenic
925917517 2:8617304-8617326 AGTAGGATTTTCAAGTTCAGGGG - Intergenic
926509305 2:13753607-13753629 AGAAGTATTTGCAAGTGTAAAGG - Intergenic
926579446 2:14618669-14618691 GGAAGGATTTTCCACTGCTTTGG + Intergenic
926794723 2:16609485-16609507 AGAAGGACTAGCAAGTGCAAGGG - Intronic
926811380 2:16757922-16757944 AGGAGGATTTCCAACTGCTCAGG - Intergenic
927103741 2:19807226-19807248 AGAAGGATCTTCAAGACCAAAGG + Intergenic
927322966 2:21769948-21769970 AGAAGTATGTGCAAGTGCTTTGG - Intergenic
929606731 2:43239750-43239772 AGGAGGATTCTCCAGAGCTAGGG - Intronic
930325981 2:49918271-49918293 AAAATCATTTTCAAGTGCCAGGG + Intergenic
930465268 2:51740087-51740109 AGAAGAACATTCAAGAGCTAGGG + Intergenic
930989788 2:57639368-57639390 AGAAGGAATGGCAAGTGCGAAGG + Intergenic
933318352 2:80741810-80741832 TGAAGAATTTACAACTGCTACGG + Intergenic
933457740 2:82538303-82538325 AGAAGCATTTTCAAATGGTTAGG + Intergenic
934106187 2:88696811-88696833 AGACAGATGTTGAAGTGCTATGG + Intronic
935359630 2:102236421-102236443 GGATGGACTTTCAGGTGCTAAGG + Intronic
936685352 2:114821076-114821098 AGAGGGAACTTCAAGTGCCAAGG + Intronic
938602038 2:132852087-132852109 AGAAGGATTTGGAAATGCAAGGG - Intronic
939639817 2:144626937-144626959 TGAAGGAATTTTAAGTGCAACGG + Intergenic
941753672 2:169161853-169161875 AGAAGGATTTTCAGGTACCAAGG + Intronic
942324219 2:174761774-174761796 AGAAGGATTATCAAGTCCCAGGG - Intronic
942417377 2:175773116-175773138 TGAAGGATTTTAAAGAGCCACGG + Intergenic
944250002 2:197572384-197572406 AGCAGGATTTTGAAGAGCTGGGG - Intronic
945978614 2:216290319-216290341 AGAGGGAATATCAAGTGCAAAGG + Intronic
947975955 2:234366561-234366583 AGAATGAAGTTTAAGTGCTAAGG + Intergenic
948503056 2:238408824-238408846 AGAGGGAATTTCAAGTCCTGAGG - Intergenic
1170222991 20:13961403-13961425 AGAAGAATTTTGAAGTGGTAGGG + Intronic
1170533926 20:17321867-17321889 AGAAGGATTTTGAAGTGAGATGG + Intronic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1172535333 20:35668530-35668552 AGAAGGAATGGCAAGAGCTAAGG - Exonic
1173227605 20:41171070-41171092 AGAAGTATTCTCAAGGGTTAGGG + Intronic
1173511081 20:43628953-43628975 AGAAGGATTTGCCAGTCCCACGG + Intronic
1174019382 20:47517875-47517897 AGAAGGATCGTCCAGTCCTAGGG + Intronic
1174322436 20:49752539-49752561 AGAAGGAACTCCATGTGCTAAGG + Intergenic
1178970223 21:37168530-37168552 AGAAAAATTTTTAAATGCTATGG + Intronic
1182541620 22:31046138-31046160 AGTAAGAGTTACAAGTGCTATGG + Intergenic
1182706396 22:32283240-32283262 AGAAGGAACTGCAAGTGCAAAGG - Intergenic
1182755221 22:32673715-32673737 AGAAGGATTTGTACGTGCAAAGG + Intronic
950132930 3:10559876-10559898 AGAAGGCAGTTCAAATGCTAGGG + Intronic
950753457 3:15151177-15151199 AGAAGGATTTTTAAATCCCATGG - Intergenic
951700309 3:25489732-25489754 GAAAGGACTTTCAAGTCCTAGGG + Intronic
951989327 3:28658348-28658370 AGAAGAAATTTCAAGTGAGAGGG + Intergenic
952087654 3:29845925-29845947 AGAGGGAATTCCAAGTGCAAAGG + Intronic
952105012 3:30059438-30059460 AGAAGGAACTGCAAGTGCAAAGG - Intergenic
952860697 3:37810098-37810120 AGAAGGACATTCAAGAGCCACGG - Intronic
953211280 3:40877467-40877489 AGTAGGAAGTTCAAGTGCAATGG + Intergenic
953945029 3:47138882-47138904 AGAAGGAATCTCAATAGCTATGG + Intronic
954996149 3:54883678-54883700 AGAAGGAATAACAAGTGCAAAGG - Intronic
956068561 3:65422846-65422868 AGAAGGAGATGTAAGTGCTAGGG + Intronic
956771689 3:72532098-72532120 AGAGGGGTTTTGAAGTGCAAGGG + Intergenic
958643182 3:96835460-96835482 AGAGGGAGTATCAAGTGCAAGGG + Intronic
959530113 3:107426112-107426134 AGAACTATTTTAAAGTACTAAGG + Intergenic
960165209 3:114393744-114393766 AGCTGGATTTTCAGGTTCTAGGG - Intronic
962087521 3:132207601-132207623 AGACTGATTTTCAAGAGCTTTGG - Intronic
963664207 3:148161754-148161776 ATATGGATTTTCAACTGCAAGGG + Intergenic
964418736 3:156478345-156478367 AAAATGATTTACAAATGCTAAGG - Intronic
966486973 3:180482044-180482066 AGAATGATTGTAAAGTGCTTAGG + Intergenic
967248986 3:187517772-187517794 AAAAGGATTATCAAGAGCCAAGG + Intergenic
967668803 3:192207125-192207147 GGATGGATATTCAAATGCTAAGG - Intronic
969960951 4:10944340-10944362 AGCAGGATTTTTAAATGCTAGGG - Intergenic
971647398 4:29226658-29226680 AGATTGATTTTCAATTGCTATGG - Intergenic
971933265 4:33113814-33113836 GAAAGTATTTTTAAGTGCTAAGG + Intergenic
973695397 4:53485742-53485764 AGAAAGATTCTCTGGTGCTAGGG - Intronic
974297687 4:60023414-60023436 AGAAGCATTATCAAGTGGCATGG + Intergenic
977142486 4:93391022-93391044 TGAAGGAAGCTCAAGTGCTAAGG + Intronic
978626762 4:110693708-110693730 GCAAGGATTTTCCAGTGTTAGGG - Intergenic
979427923 4:120591076-120591098 AGAAGGCTTCTTAAGTCCTATGG + Intergenic
979635188 4:122948996-122949018 AGAAAGTTTTTCAAGGGCTTAGG + Intronic
981646500 4:147004538-147004560 AGTAGGTTTTTCAACTGGTATGG + Intergenic
982056605 4:151556059-151556081 TGAACGATTCTCTAGTGCTAAGG + Intronic
983652706 4:170049341-170049363 AAAAGGATTTTCAAGTTGTCAGG - Intergenic
984065216 4:175038968-175038990 AGAAGGAATGTCAAATGCAAGGG - Intergenic
984375545 4:178924219-178924241 AGAAGAAATTTCAACTCCTATGG - Intergenic
984574494 4:181431858-181431880 AGGAGGATTTTCACATGCAATGG - Intergenic
987856042 5:23422203-23422225 AGAAGGATAATCAAGGGCAAGGG + Intergenic
990862857 5:60347217-60347239 AGAAAGAATGTCAAGTGCAAAGG + Intronic
992071152 5:73150715-73150737 AGAAGGATTGCAAAGTGCCAGGG - Intergenic
992245220 5:74814404-74814426 AAAAGGATATTCAGGTACTAAGG - Intronic
992440053 5:76789960-76789982 AGCAACATTTACAAGTGCTAGGG - Intergenic
993286305 5:86001946-86001968 AGAAGGATTGCCAGGGGCTAAGG - Intergenic
994096728 5:95853922-95853944 AGAAGGAGGTTCAGATGCTAAGG + Intronic
994792530 5:104248278-104248300 AGGAAGATTCTCATGTGCTAAGG + Intergenic
995384210 5:111570636-111570658 AGAGATATTTTAAAGTGCTATGG - Intergenic
996227726 5:121021887-121021909 AGTAGAATTTTTAAGTGCAAGGG + Intergenic
996723366 5:126651528-126651550 AAAAGGATTTTCAAGCAATAAGG + Intergenic
997109914 5:131063803-131063825 AGGATGATTTTCAGGGGCTAGGG + Intergenic
998742467 5:145220185-145220207 AGATGGATTATCAAGTCCAAAGG + Intergenic
999831251 5:155322394-155322416 AAAAGGATGTAAAAGTGCTACGG + Intergenic
1000810514 5:165855685-165855707 AAGAGAATTTTAAAGTGCTATGG + Intergenic
1003664249 6:8095054-8095076 ACATGGATTTTCAACTGCTCAGG + Intronic
1004556587 6:16704552-16704574 GGTAAGATTTTCAAGTGCTGGGG - Intronic
1005287876 6:24348218-24348240 TGAAGGATTCTGAAGAGCTAAGG + Intronic
1005571382 6:27148674-27148696 AGAGGGAATTTAAAGTGCAAAGG - Intergenic
1008242933 6:49134557-49134579 AGAATGAATCTAAAGTGCTATGG + Intergenic
1009399409 6:63236690-63236712 AGGAGGGTTTTTAAGTGCTGGGG + Intergenic
1009809833 6:68646508-68646530 AGATGGACTTCCAAGTGCTGGGG + Intronic
1009930482 6:70171996-70172018 AGAAGGATTTCCAGGTGTAAAGG + Exonic
1009935277 6:70226715-70226737 AGAATGATTTTCAAGTCTTCTGG - Intronic
1009992773 6:70864324-70864346 GGAAGGATATTCCTGTGCTAAGG - Intronic
1010087769 6:71940652-71940674 AGAAGGATTTTCAAGTGCTAGGG + Intronic
1010143716 6:72641525-72641547 GGCAGGATTTTCAAGAGTTAGGG - Intronic
1011767120 6:90634184-90634206 AGCAGGATTTTCCATTGATAGGG + Intergenic
1012071989 6:94633370-94633392 AGAAAGTTTTTGAATTGCTAAGG - Intergenic
1015300168 6:131644047-131644069 AGAAGGACTATCAAGTGCAAAGG + Intronic
1015788043 6:136937989-136938011 AGAAGGATTTTTAAGTTTAATGG + Intergenic
1016140494 6:140603150-140603172 AAAATGATTTTCAATTGCTTTGG - Intergenic
1017559029 6:155606907-155606929 AGAAGGAATTCCAAGTGATATGG - Intergenic
1019800736 7:3086386-3086408 AGAAGGACTTTGAAGTGTTGAGG - Intergenic
1020340781 7:7108165-7108187 ATAAAGATTATAAAGTGCTATGG + Intergenic
1020494690 7:8834919-8834941 AGAAGGAAGTTCAAGTGTGAGGG + Intergenic
1026233810 7:68508887-68508909 AGGAGGGTTTTCAATTGCTTTGG + Intergenic
1026382274 7:69811665-69811687 AACAGGATTTTCAAGTCCCATGG - Intronic
1029188524 7:98755878-98755900 AGAAAGAGTTTCATGTGCTGTGG - Intergenic
1030502989 7:110383636-110383658 AGAAGGTTTTTCCAGGGCCAAGG - Intergenic
1031180588 7:118409833-118409855 AGAAGGAATTTCATTTGCTTTGG - Intergenic
1032873820 7:136015664-136015686 ATAAGGATTTTGAAGAGCTGTGG - Intergenic
1033818717 7:145107650-145107672 AAAAGGATATTCAATTGATATGG - Intergenic
1035558004 8:580588-580610 AGAAGGATGTACGAGTGCTATGG - Intergenic
1035655903 8:1304372-1304394 AGGAGGAATTTCAAGTGCCCAGG + Intergenic
1037028417 8:14070006-14070028 AGAAGGAAGTTAACGTGCTAGGG + Intergenic
1037354527 8:18002955-18002977 AGAAGTATTAGCAAGTGCCAAGG - Intronic
1037575115 8:20195243-20195265 AGAGGGTTTTGCAAGTGCCAAGG - Intergenic
1038813123 8:30871969-30871991 AGAAGGATATACTTGTGCTAAGG - Intronic
1040055580 8:43054775-43054797 AGTAGTATTTTCAGGTGCCACGG + Intronic
1042028386 8:64447828-64447850 AGAAGGAATTGCAAGTGCAAAGG - Intergenic
1042756191 8:72214496-72214518 AGAAGGAATCTCAAGTTCTGAGG + Intergenic
1043364345 8:79515326-79515348 ACATGGATTTTCAACTGCTAAGG - Intergenic
1044530260 8:93299564-93299586 AGAAGGATTCCCAAATGCAAAGG + Intergenic
1044591876 8:93920934-93920956 AGAAGTATTTTCATCTACTATGG - Intronic
1045742148 8:105374001-105374023 AAAAGGTTGTTCAAGTGCTGGGG + Intronic
1046456996 8:114478923-114478945 AGAATGATATTCCAGTGCTAGGG + Intergenic
1046476727 8:114755092-114755114 GGAAGGATTTTTAAGGGCTAGGG + Intergenic
1046811759 8:118540729-118540751 ATAAAAATTTTCAAGAGCTAAGG - Intronic
1051178658 9:14387018-14387040 AGAATGCTTTTCAAGGACTAGGG + Intronic
1052203913 9:25814761-25814783 AGCAGGATTCTCAAGGGCTCAGG + Intergenic
1052605362 9:30691519-30691541 TGAAAGATTTTCATGTGCTATGG + Intergenic
1054781587 9:69171045-69171067 AGACTGATTTTCAAGTGCTATGG - Intronic
1056983882 9:91343147-91343169 AGGAGGATTTTCAACTGTGAGGG + Intronic
1058273774 9:103011323-103011345 AACAGGTTTTTCAAGTACTAGGG + Intronic
1059059592 9:111021449-111021471 AAAAAGATTTTAAAGGGCTAAGG - Intronic
1059229235 9:112703023-112703045 AGAAGAATATTCAATTGCTCTGG + Intronic
1059277653 9:113109367-113109389 GGAAGGAGTTTCCAGTGCCATGG + Intergenic
1059278598 9:113115184-113115206 GGAAGGAGTTTCCAGTGCCATGG - Intergenic
1060286846 9:122261294-122261316 AGAAGAATTTTCAAGGGGTGTGG - Intronic
1061778220 9:132980251-132980273 ACAAGGATTTTCAAAGGCTCTGG + Intronic
1186071135 X:5821890-5821912 AAAGGGATGTTTAAGTGCTATGG - Intergenic
1186439414 X:9572812-9572834 AGCAGGATATTCATTTGCTAGGG + Intronic
1186623734 X:11269222-11269244 AGGAGGAGTTTCAAGCGCAAGGG - Intronic
1187747505 X:22425672-22425694 AGAAGTAGTTTCAAGAACTATGG + Intergenic
1190204734 X:48393973-48393995 TGAATGATTTTCAAGTTCAAGGG + Intergenic
1190205802 X:48401430-48401452 TGAATGATTTTCAAGTTCAAGGG - Intergenic
1190481746 X:50884281-50884303 ACAAGGATTTTGAAGTCCTGAGG - Intergenic
1191012841 X:55778659-55778681 AGAAGGAGTTTTTAGTGCTGTGG + Intergenic
1191219738 X:57975671-57975693 AAAAGGATTTACATGTGCTTAGG + Intergenic
1191979490 X:66910388-66910410 AGAAGGAATGGCAAGTGCAAAGG + Intergenic
1194173568 X:90618492-90618514 AGAAATATTTTTAAGTGATAAGG - Intergenic
1194423339 X:93704850-93704872 AGAAGGAATATCAGATGCTAAGG - Intronic
1196309531 X:114146737-114146759 ACATGGTTTTTCAAGTGCAAAGG - Intergenic
1196595912 X:117545374-117545396 AGTAGGATTTTGAAGTGCCTCGG - Intergenic
1198772598 X:140146976-140146998 AAAAGCATTCTCAAGTGCTGTGG - Intergenic
1199898599 X:152150764-152150786 AGAAAGAAATTCAAGTGCTTGGG - Intergenic
1200519788 Y:4196183-4196205 AGAAATATTTTTAAGTGATAAGG - Intergenic