ID: 1010095441

View in Genome Browser
Species Human (GRCh38)
Location 6:72037888-72037910
Sequence AACTGATGACCTTTAACATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010095439_1010095441 27 Left 1010095439 6:72037838-72037860 CCTCAAATGAAATGAAGCTGTTT 0: 1
1: 0
2: 2
3: 27
4: 329
Right 1010095441 6:72037888-72037910 AACTGATGACCTTTAACATTTGG 0: 1
1: 0
2: 0
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010095441 Original CRISPR AACTGATGACCTTTAACATT TGG Intronic
903796446 1:25932365-25932387 AACTCATGACCTTAAATAATGGG - Intergenic
905497434 1:38403663-38403685 ACCTGATGGCCTTTACCATCAGG + Intergenic
907084203 1:51654448-51654470 AATTCATTACCTTTAAAATTTGG - Intronic
909345890 1:74586890-74586912 AAAAGATCACTTTTAACATTTGG - Intronic
909607667 1:77522931-77522953 CACTCATCACCTTTAACATGAGG - Intronic
910759698 1:90722129-90722151 AACTGCTCATCTTTAAAATTTGG - Intergenic
912139833 1:106710620-106710642 ACCAGATGAACTTTAAAATTAGG - Intergenic
916623767 1:166530759-166530781 AGCTGAAGAGCTTTAACTTTTGG - Intergenic
916653004 1:166848305-166848327 AACTGATGACATTTTAGTTTGGG + Intronic
918510821 1:185312212-185312234 GACTGATTACCTTGAAGATTAGG - Intronic
919431338 1:197496192-197496214 ATCTAATGACTTTCAACATTAGG - Intergenic
919588966 1:199475433-199475455 AATTAATGGCATTTAACATTAGG - Intergenic
921595784 1:217052303-217052325 AACAGATCAACTTTAAGATTTGG + Intronic
922520958 1:226251836-226251858 AACTCATGGATTTTAACATTTGG - Intronic
1065678202 10:28201000-28201022 AACTGATGACGTTTATGACTTGG - Intronic
1067460378 10:46453845-46453867 CACTGATGAACTATAACAGTTGG + Intergenic
1067626812 10:47930758-47930780 CACTGATGAACTATAACAGTTGG - Intergenic
1068133696 10:52927797-52927819 AACTTATGACCGTTACCATGTGG - Intergenic
1068153220 10:53161715-53161737 AAGTGATAACCTCTAACATGTGG - Intergenic
1072940203 10:99756558-99756580 TAGTGATGAACTTTACCATTGGG - Intergenic
1075447290 10:122521972-122521994 CACTGATGACCTTTCACAGGAGG - Intergenic
1077822159 11:5756764-5756786 TACTGATGACTTTTAGCTTTAGG - Intronic
1077911545 11:6576288-6576310 AACTGATGTTCTTTAACAAAAGG + Intronic
1078061888 11:8053138-8053160 AACTTACGACATTTATCATTAGG + Intronic
1078377175 11:10806088-10806110 AATTTATGATGTTTAACATTTGG - Intronic
1082077734 11:47987402-47987424 AACTGATCATCTTTACAATTTGG - Intronic
1083427636 11:62596846-62596868 AACTGAGGACCTGAAACTTTTGG + Intronic
1084555454 11:69873146-69873168 AACTGATGAGCTATTACATAGGG - Intergenic
1084747079 11:71179251-71179273 AACTGATCAAATTTAACATTTGG + Intronic
1085714421 11:78859245-78859267 GACTGTTGCCCTTTAACTTTTGG - Intronic
1088343192 11:108792677-108792699 AATGGATGCCCTTTAACTTTTGG + Intronic
1093083593 12:14841861-14841883 AACTGATGCCCTTTGCCATCAGG + Intronic
1095540353 12:43302715-43302737 AACTGAGGACCTAAAATATTTGG + Intergenic
1095865326 12:46965544-46965566 AACTGAAGACTTTTAAAGTTTGG + Intergenic
1097292778 12:57933028-57933050 CACTGATGACTTTAAACAATTGG - Intergenic
1105828307 13:24142382-24142404 AACTAAAGAACTATAACATTTGG - Intronic
1107818524 13:44265939-44265961 ACCTGAAGAGCTTCAACATTTGG - Intergenic
1109261559 13:60150660-60150682 AACTGATGCCCTTAGACACTGGG - Intronic
1109468168 13:62766509-62766531 AACTGAAGAACTTGAACATGTGG + Intergenic
1110187788 13:72694836-72694858 AGCTGAAGACCTAAAACATTGGG + Intergenic
1110223465 13:73096204-73096226 AACTGAGGAGCTTTAACACTTGG - Intergenic
1113969563 13:114178257-114178279 CTCTGATGATCTTCAACATTTGG - Intergenic
1114127023 14:19740200-19740222 AACTGAAAACCTTTAAAATCTGG + Intronic
1116498405 14:45590599-45590621 AGCTGATGACCTTCACCTTTAGG - Intergenic
1116537113 14:46046008-46046030 AACTGATGACACTTTAAATTTGG + Intergenic
1117919745 14:60716714-60716736 AATTAATTACCTTTAACATTGGG - Intronic
1118901416 14:69989455-69989477 AACTGCTTACTTTTAAAATTGGG - Intronic
1120072205 14:80116506-80116528 AACTTTTGATCTTTAACTTTTGG - Intergenic
1120568983 14:86094332-86094354 ACCTGATGACTTTTAATCTTAGG + Intergenic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1127570807 15:60239205-60239227 CACTGATGGTCTTTACCATTTGG - Intergenic
1129056880 15:72826450-72826472 AACTGATGAACTTTGAGATCAGG + Intergenic
1130796217 15:87212559-87212581 ATCTCATAACCTTTATCATTTGG + Intergenic
1131822315 15:96285681-96285703 AACAGACGTCCTTTCACATTGGG - Intergenic
1137461316 16:48666740-48666762 CACTGATGGCCTTTACAATTTGG + Intergenic
1139150762 16:64379745-64379767 AACTGATGACCTTATTCATTTGG - Intergenic
1139695613 16:68672241-68672263 TTCTGATGACCTTCATCATTGGG + Intronic
1139877662 16:70159288-70159310 AACTGATGTCATTTAACAGGAGG - Exonic
1143319053 17:6056089-6056111 AACTGGGGACCTTTAACTTCAGG + Intronic
1147480266 17:40754842-40754864 AATTGATGACCTTAAAAATCAGG - Exonic
1149399012 17:56274844-56274866 ATCTAATGGCCTTTAACCTTGGG - Intronic
1153813482 18:8772520-8772542 ACATGATGACCATTAACATTTGG + Intronic
1153904766 18:9651387-9651409 ATCTGATTACCTTTATCCTTTGG - Intergenic
1155266227 18:24096966-24096988 AATTGGTGCCCTTTAAAATTAGG + Intronic
1156744922 18:40378428-40378450 AATTTATGACATATAACATTTGG + Intergenic
1157027019 18:43856946-43856968 AATGGATGAACTTAAACATTGGG + Intergenic
1157081648 18:44531988-44532010 AACTGATGTCCTTATACAATTGG + Intergenic
1158094020 18:53749630-53749652 AACTGATCAGGTTTAACTTTTGG - Intergenic
1158169850 18:54585545-54585567 CACTGAGGACCTTTAAGATTTGG + Intergenic
1158623061 18:59049191-59049213 TACTGATAACCTTTAACATCAGG - Intergenic
925301275 2:2814532-2814554 AACTGATGACTTTTCAAATCTGG + Intergenic
926228455 2:10984897-10984919 AAGTAATGACCATTAACATCTGG + Intergenic
933368581 2:81387140-81387162 AATTGATGACCTTTGAAAATTGG - Intergenic
938667976 2:133558851-133558873 AACTGTTGACATTTGACATTAGG + Intronic
939464651 2:142541777-142541799 AATTGTTGACCTATAAAATTTGG - Intergenic
943107537 2:183565006-183565028 AACAGATGAGTTTTAACATAAGG + Intergenic
943294849 2:186124767-186124789 AAAAAATAACCTTTAACATTAGG + Intergenic
943402927 2:187438746-187438768 AAGGAATGACCTTTCACATTAGG - Intronic
946856167 2:223951939-223951961 AAGTTCTTACCTTTAACATTTGG + Intergenic
1169752963 20:9013908-9013930 AACTGATGACTTTAACCACTGGG - Intergenic
1170079241 20:12453423-12453445 AACTGTTTACCTTTAACTTATGG - Intergenic
1179966874 21:44812380-44812402 AACTTTTCACTTTTAACATTGGG + Intronic
949579674 3:5375421-5375443 CATTGATGATCTTTACCATTTGG + Intergenic
952101213 3:30015594-30015616 AACTGAAGGTCTTTAAAATTTGG - Intergenic
953933247 3:47017646-47017668 AACTGAAGACTTTAAACATCTGG - Exonic
953944420 3:47134104-47134126 AAGTGATTACCTTCACCATTAGG + Intronic
954858281 3:53665394-53665416 GAATGATGAACTTTGACATTGGG + Intronic
954988959 3:54822023-54822045 AACTGATAACTATTTACATTTGG + Intronic
955122666 3:56076406-56076428 ACCTGATGACATTGTACATTTGG - Intronic
956092444 3:65682304-65682326 AAATGATGAGCCTTAAAATTGGG - Intronic
956921696 3:73936694-73936716 TACTGAGCACCTTTAACATTTGG - Intergenic
958643015 3:96833015-96833037 AACTAATAATCTTTAACACTGGG - Intronic
959862172 3:111229010-111229032 AAGTGAAGACCTTTAAGATGAGG + Intronic
961597893 3:128033620-128033642 AACTAATGACCTTCAAGGTTTGG - Intergenic
961927620 3:130498115-130498137 AACTGATTTCCTTTAAGTTTAGG + Intergenic
963511653 3:146255294-146255316 GGCTGATCACCTTTAACATCCGG + Intergenic
973534073 4:51863227-51863249 ATTTCATGAACTTTAACATTTGG + Intronic
973676892 4:53272743-53272765 AACTCACGTCATTTAACATTAGG - Intronic
973858503 4:55037192-55037214 AAATGATGTCCTTTAAAAGTCGG + Intergenic
973970456 4:56208275-56208297 AACTCAGGACCTTGAACCTTGGG - Intronic
976193551 4:82512006-82512028 AACTCATGACCTATAGCCTTGGG - Intronic
977178145 4:93839994-93840016 AACTGATTACAGTCAACATTGGG + Intergenic
977880032 4:102193601-102193623 AAATGTTGACCATTATCATTGGG - Intergenic
977920669 4:102639144-102639166 AACTGGTCACCTTTCCCATTCGG + Intronic
978115599 4:105016625-105016647 CATTGATGATCTTTAAAATTTGG - Intergenic
981474790 4:145178010-145178032 AGCTGAAGACCTTGAACTTTGGG - Intronic
981630780 4:146816120-146816142 AACTGATGAAATTTAACTTCTGG - Intronic
981711342 4:147711462-147711484 AACTGCTGATATTTGACATTAGG - Intergenic
982876379 4:160655865-160655887 AACTCATTACCTTTAACAAATGG - Intergenic
984298607 4:177886495-177886517 TAGTGATAACTTTTAACATTTGG + Intronic
984548828 4:181136949-181136971 TACTGACGACCTTTACCATTAGG - Intergenic
986316518 5:6592303-6592325 AACTGATCACCTTTCACGATCGG - Intergenic
987840403 5:23216531-23216553 AACTGCTGACGTTTACTATTTGG - Intergenic
988395215 5:30688514-30688536 AACTAAAGACCTTTATAATTTGG + Intergenic
989670961 5:43916502-43916524 CACTGATGATCTTTACAATTTGG + Intergenic
989782299 5:45282528-45282550 ATCTCATGACCATTCACATTTGG + Intronic
994247074 5:97489700-97489722 CACTGTTGACTTTTAACACTAGG + Intergenic
994927523 5:106136771-106136793 AACTAATTACCTTTACCTTTTGG - Intergenic
995718826 5:115107935-115107957 ATTAGATGACCTTTGACATTTGG - Intergenic
997162797 5:131626530-131626552 AATTCATGACATTTAACACTGGG + Intronic
997768541 5:136529801-136529823 AAATGATGACAGTTAACAATTGG + Intergenic
1002821847 6:733046-733068 AACTGATGACTTTTATTACTTGG + Intergenic
1004010257 6:11678591-11678613 GACTGATGAGTTTTAGCATTAGG - Intergenic
1004946812 6:20624046-20624068 GACTGATAACCTTTGACATGAGG + Intronic
1007199474 6:40094422-40094444 CACTGATGGTCTTTAAAATTTGG + Intergenic
1010095441 6:72037888-72037910 AACTGATGACCTTTAACATTTGG + Intronic
1011309447 6:85966049-85966071 AACTGATGAACTATAGCATAGGG + Intergenic
1011955807 6:93024458-93024480 AAGTGAAGATGTTTAACATTTGG + Intergenic
1014550385 6:122783644-122783666 ATATGATGATCTTTAAAATTCGG + Intronic
1015623892 6:135160072-135160094 AACTCATGACCTGTGACATGGGG + Intergenic
1018915432 6:168129808-168129830 AACTGATGACCACTAACGGTTGG - Intergenic
1020687861 7:11317953-11317975 AACTGATGGACTTTCACAATAGG + Intergenic
1020853601 7:13389358-13389380 AACTGATTGTCTTAAACATTAGG - Intergenic
1021165157 7:17329730-17329752 AACTGATGACAAGTAACTTTTGG + Intronic
1022676475 7:32504562-32504584 AACTGAAGTCCATAAACATTAGG - Intronic
1028656223 7:93210707-93210729 AAATCAGGACCTTTAAGATTAGG - Intronic
1028908351 7:96179412-96179434 AACTGATGACCTTAGAAAATTGG - Intronic
1028948269 7:96605194-96605216 AACTGATGACCTTCCTCACTAGG - Intronic
1029876039 7:103752789-103752811 AACTGAAGTCATTTAAGATTTGG - Intronic
1031648590 7:124257928-124257950 AACAGATGACCTTGAAAAGTGGG - Intergenic
1032989464 7:137375952-137375974 AGTTGATGACCTTTCATATTTGG + Intergenic
1033014407 7:137657654-137657676 AACTCAGGACCTTTCACACTTGG - Intronic
1033563832 7:142559508-142559530 AACTAATGCCCTTTTACTTTGGG + Intergenic
1037180374 8:15997476-15997498 AACTGTTGACTTTTATCATATGG + Intergenic
1041208399 8:55522201-55522223 TACAAATGACTTTTAACATTTGG + Intronic
1041348346 8:56924194-56924216 AATTAATGAACTTTTACATTAGG - Intergenic
1041789296 8:61674382-61674404 AACTGAAGTCCTTGAATATTTGG + Intronic
1044217044 8:89624506-89624528 AACAGATGACCTGTCTCATTGGG + Intergenic
1044394287 8:91691698-91691720 ATTTGAAGACATTTAACATTTGG + Intergenic
1044524435 8:93236234-93236256 AAGTGCTGAACATTAACATTTGG - Intergenic
1044574254 8:93751156-93751178 AACTCATGTCCTTTAACACTGGG - Intergenic
1044866018 8:96572030-96572052 CACTGATGGCCTTTAACAGAAGG - Intronic
1045811405 8:106224125-106224147 ACCTGATGACCTATATCAATGGG - Intergenic
1050167326 9:2779043-2779065 AACAGATGTCCTTTAACACGGGG + Intronic
1051083349 9:13318537-13318559 AACTCATGACCTTTATTACTGGG - Intergenic
1052361072 9:27558831-27558853 ATCTCAAAACCTTTAACATTTGG + Intronic
1055735474 9:79324699-79324721 AGCTGATTACCTTTAACTTTTGG + Intergenic
1056016144 9:82390267-82390289 CATTGATGACCTTTACAATTTGG + Intergenic
1059492320 9:114678858-114678880 AATTGTTGACCTTCAACAATGGG + Intergenic
1061472569 9:130838389-130838411 AAATGATTAGCTTTAACAGTAGG + Intronic
1185912235 X:3992655-3992677 CTCTGATGACCTTGAACTTTTGG + Intergenic
1186538009 X:10369737-10369759 AATACATGACCTTTAACATCTGG - Intergenic
1186597443 X:10999089-10999111 CACTGGTTACCTTTAAAATTGGG + Intergenic
1187713578 X:22078589-22078611 AAACGATGAACTTTAAGATTTGG - Intronic
1188163076 X:26826310-26826332 AATAGAAAACCTTTAACATTAGG + Intergenic
1188689290 X:33109169-33109191 AACTGTTTAGCTTTAACATAAGG + Intronic
1196749540 X:119102712-119102734 AAATGCTGGCATTTAACATTTGG - Intronic
1198128032 X:133666659-133666681 CACTGATTACTTTTAAAATTTGG - Intronic
1198626065 X:138576349-138576371 AACTGAGGACTTTCAGCATTGGG - Intergenic