ID: 1010104069

View in Genome Browser
Species Human (GRCh38)
Location 6:72147530-72147552
Sequence TGGGACTCCTTGGGAAACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 17, 3: 38, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010104069_1010104076 0 Left 1010104069 6:72147530-72147552 CCTCTGTTTCCCAAGGAGTCCCA 0: 1
1: 0
2: 17
3: 38
4: 257
Right 1010104076 6:72147553-72147575 GGCTATCAAAAGCTATTCTAGGG 0: 1
1: 0
2: 0
3: 8
4: 123
1010104069_1010104075 -1 Left 1010104069 6:72147530-72147552 CCTCTGTTTCCCAAGGAGTCCCA 0: 1
1: 0
2: 17
3: 38
4: 257
Right 1010104075 6:72147552-72147574 AGGCTATCAAAAGCTATTCTAGG 0: 1
1: 0
2: 0
3: 17
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010104069 Original CRISPR TGGGACTCCTTGGGAAACAG AGG (reversed) Intronic
900197092 1:1381949-1381971 TGGGGCTCCTGGGGAACCACTGG + Intergenic
901467373 1:9431032-9431054 TGGGATTCTTTGGGAAGCCGAGG + Intergenic
901509631 1:9710342-9710364 AGGGACTCCCTGGAAAACAGTGG - Intronic
901838571 1:11939476-11939498 TGGGACTGCTTGGGGAGGAGGGG + Intronic
902933321 1:19746345-19746367 AGTGACTCCCTGGGAGACAGAGG - Intronic
903006997 1:20305388-20305410 TGGCAGGGCTTGGGAAACAGAGG + Intronic
903951756 1:26999686-26999708 TGGGACTCCTGGGGAAGCAGAGG - Intronic
904717688 1:32481421-32481443 TGGGGCTCGGTGGGAAACTGAGG - Intronic
905037409 1:34927158-34927180 TGGGACTCCTTGCCAAAGAGAGG - Intronic
905310607 1:37046432-37046454 TGGTAGTGCTTGGGAAATAGAGG - Intergenic
906964798 1:50445705-50445727 TGGGACTCCTTGGGGGAGAAGGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907964233 1:59313793-59313815 GGGGACTCAGTGGGAAAGAGCGG + Intronic
908478940 1:64517919-64517941 TTGTATTCCTTGGGAAACAAAGG + Intronic
912237676 1:107869383-107869405 TGGGATTCATTGGTAAACATAGG - Intronic
913268066 1:117064631-117064653 TGGGACTACTTGGGAGGCTGAGG - Intronic
915001712 1:152600316-152600338 TGGGAGTGTTTGGGAAAGAGAGG + Intronic
916031201 1:160878954-160878976 TGAGATTCCTTGAGAAACACAGG - Intronic
917066533 1:171100744-171100766 TGTGAATCCTTGGGAACCAGAGG + Intronic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
918086660 1:181251329-181251351 TTGGGCTCCTTGCAAAACAGGGG + Intergenic
919104064 1:193127439-193127461 TGGGACTACTTGGGAAAATAAGG + Intronic
919902867 1:202056966-202056988 TGGGCCTCCTGGGGAACCATGGG + Intergenic
919967364 1:202541476-202541498 TGTGGCTCCTTGGGAAAAAAAGG - Intronic
920747452 1:208642613-208642635 TGGGCCTCCTTGGGTCAGAGTGG - Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921655978 1:217737767-217737789 TGGGGCTCTTTGTGAAGCAGTGG - Intronic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063565443 10:7169346-7169368 TTGGACTTCTCGGGACACAGGGG + Intronic
1064081194 10:12309197-12309219 GGGGACTCCTTCTGAGACAGCGG + Intergenic
1064380407 10:14837317-14837339 ACTGACTCCTTGGGAAAGAGAGG - Intronic
1065756633 10:28936577-28936599 TGGGACTCCTTTGAGAGCAGAGG + Intergenic
1068567364 10:58590868-58590890 TGCCAATCCTTAGGAAACAGTGG + Intronic
1069753895 10:70761716-70761738 GGGGACTCTGTGGGACACAGAGG + Exonic
1069960532 10:72076414-72076436 TGGGGCTTCTCAGGAAACAGAGG + Intronic
1070865441 10:79705811-79705833 TGTTACTTCTTGGGAGACAGGGG + Intronic
1070879235 10:79843942-79843964 TGTTACTTCTTGGGAGACAGGGG + Intronic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1071560727 10:86645120-86645142 GGGGACTCCTTGGGAGACCAAGG - Intergenic
1071632341 10:87228032-87228054 TGTTACTTCTTGGGAGACAGGGG + Intronic
1071645794 10:87360250-87360272 TGTTACTTCTTGGGAGACAGGGG + Intronic
1074037923 10:109759600-109759622 TGGGACTCATTGGGTATCACTGG - Intergenic
1074424935 10:113342426-113342448 CTGGTCTCCTGGGGAAACAGTGG + Intergenic
1076785398 10:132747208-132747230 CGGACCTCCTTGGGACACAGGGG + Intronic
1077460726 11:2708051-2708073 TGGGAAATCTTGGGAAACAGGGG - Intronic
1077920572 11:6639139-6639161 TAGGACTACTTGGGAAGCAAAGG - Intronic
1078044882 11:7904572-7904594 TGGGACTCCTTCAGGAATAGTGG + Intergenic
1078769363 11:14333757-14333779 TGCAGCTACTTGGGAAACAGAGG - Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080120629 11:28673350-28673372 TGGGACAGCATGGGATACAGTGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080961922 11:37170686-37170708 AGGGTCTCTTAGGGAAACAGTGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083339572 11:61950349-61950371 TGGGACTCCCTGGGACTCTGTGG - Exonic
1083945160 11:65919359-65919381 TAGGACTCCGCGGGAAACGGCGG + Exonic
1084572110 11:69966089-69966111 TGACACTGCTTGGGAAACAAAGG + Intergenic
1084586644 11:70066378-70066400 TGGGACTGAGTTGGAAACAGGGG + Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1085277139 11:75307486-75307508 TGGGACTCTCTGTGTAACAGAGG - Intronic
1085416210 11:76320745-76320767 TGGGTTTCCTTGGGAGGCAGAGG - Intergenic
1088504832 11:110517503-110517525 TGGGAATCTTTGGGAAAGACTGG - Intergenic
1089648023 11:119892888-119892910 TGAGACTCCTCGGGTTACAGAGG + Intergenic
1089910688 11:122097413-122097435 TGGCATTTCTTTGGAAACAGAGG + Intergenic
1090242819 11:125196020-125196042 TGGGTCTGCTTGGGAAGCTGGGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1096687840 12:53300453-53300475 AGGGACTCCCTGGGAACCAAAGG - Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098042917 12:66370262-66370284 GGAGACTGCCTGGGAAACAGTGG - Intronic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1099400260 12:82194837-82194859 TGGGTCTCCTTGGGAAAGGATGG - Intergenic
1099555189 12:84101700-84101722 TGGGAATGCTTGGGAGACTGGGG - Intergenic
1100809361 12:98323476-98323498 GGGGACTACTAGGGAGACAGAGG - Intergenic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1101591948 12:106132606-106132628 TGAGGCTGCTTGGGAAACAAAGG + Intronic
1102781556 12:115570213-115570235 GGGGGCTCCTTGGGAAATGGTGG - Intergenic
1103043727 12:117717897-117717919 TGGAACTACTTGAGACACAGAGG + Intronic
1103180408 12:118906401-118906423 TGTTACACCTTGGGAAACACTGG - Intergenic
1104443185 12:128812070-128812092 TGGGAATCCGTGAGAACCAGTGG - Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1108708003 13:53007289-53007311 TGGGACACCTTGGGAGGCACAGG - Intergenic
1116856076 14:49953422-49953444 TGGCACACCTAGGGAGACAGAGG - Intergenic
1117539569 14:56733471-56733493 TGGGACTCCTGGAGAGGCAGAGG - Intergenic
1117598571 14:57349481-57349503 TGTGACTCATTGGGAATCACTGG + Intergenic
1119114670 14:72008405-72008427 TGGGAGTCCTTGGGAGCCAAAGG + Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119395811 14:74325633-74325655 TGGGACTCCTGAGTAGACAGGGG - Intronic
1120490831 14:85176758-85176780 TGTGAGTGCTGGGGAAACAGTGG - Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121029172 14:90643482-90643504 TGGTACACATTGGGAAAGAGTGG + Intronic
1121271282 14:92639705-92639727 TCGGACTAATGGGGAAACAGGGG - Intronic
1121796873 14:96742580-96742602 TGAAACTCCCTGGGGAACAGGGG - Intergenic
1121976197 14:98406211-98406233 TGGGCCTCCTAGGGAAATAAAGG + Intergenic
1122065037 14:99167052-99167074 TGGGAGTGCTTGGAAAACATGGG + Intergenic
1122316917 14:100831187-100831209 TGCCACTCCCAGGGAAACAGAGG + Intergenic
1123907928 15:24938713-24938735 GGGGACTCCAAGGGAAACACAGG + Intronic
1124140437 15:27072688-27072710 TGGGGCACCTTGGGAGCCAGGGG - Intronic
1125497203 15:40207952-40207974 TGGGACTACTTGGGAGGCTGAGG - Intronic
1126142610 15:45450347-45450369 AGGCAGTCCATGGGAAACAGGGG + Intergenic
1127711792 15:61606149-61606171 TGGGGGAACTTGGGAAACAGGGG - Intergenic
1128179806 15:65592159-65592181 TGGGACCCTTTGAGAAACTGGGG - Intronic
1128527132 15:68420247-68420269 TGGGACTTCCTAGGAAACAAGGG - Intronic
1132257083 15:100385037-100385059 AGGCACTCCTTAGGAAAGAGAGG - Intergenic
1132649734 16:1015029-1015051 TAGGGATCCATGGGAAACAGTGG - Intergenic
1133264350 16:4574575-4574597 TCCCACTCCTTGGGAAACACTGG + Intronic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1140868150 16:79082229-79082251 TATGTCGCCTTGGGAAACAGAGG + Intronic
1142567962 17:852854-852876 TAGGCATCCTGGGGAAACAGTGG - Intronic
1143653461 17:8278847-8278869 TGGGCCTCCTGCGGAGACAGAGG - Intergenic
1144367603 17:14559637-14559659 TGGGACACCTTTAGAAAGAGTGG + Intergenic
1145912036 17:28548508-28548530 AGGGAATCCTTGGGCCACAGAGG - Intronic
1147191403 17:38740143-38740165 TGGGAATCCTTAGGTCACAGAGG - Intronic
1148810527 17:50287769-50287791 TGGGACTACTTGGGAGGCTGAGG + Intergenic
1149501149 17:57153411-57153433 CGGGCTTCATTGGGAAACAGAGG + Intergenic
1151046870 17:70930588-70930610 TGGGACTACTTGGGAGGCCGAGG - Intergenic
1152036540 17:77876686-77876708 TGGGTCTCAGTTGGAAACAGTGG + Intergenic
1152792756 17:82290976-82290998 TGGGACCCCTTGGCCAAGAGGGG + Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155072677 18:22329980-22330002 TGGGTCTCCGTGGGAAACACAGG + Intergenic
1155131927 18:22944292-22944314 AGAAAATCCTTGGGAAACAGGGG - Intronic
1155649423 18:28122533-28122555 TTGGACTCCATGGTAAAGAGTGG + Intronic
1156269561 18:35518275-35518297 TTGAACTCATTGGGAAACATTGG + Intergenic
1156363949 18:36408542-36408564 AGAGACTTCTTGGCAAACAGAGG + Intronic
1157396510 18:47346051-47346073 TGCTGCTCCTTGGGAAAGAGGGG + Intergenic
1163380064 19:16960117-16960139 AGGCACTCCTTAGGAAACAGAGG - Intronic
1163520280 19:17787932-17787954 TGGGGATCCTTGGGAAAGATAGG + Intronic
1163754905 19:19100917-19100939 TGGGACTCATTGAGAAGCAGGGG - Intronic
1163834006 19:19562478-19562500 TGAGACTCGGTGGGAAAAAGGGG + Intronic
1165152757 19:33770633-33770655 TGGGCCTCCTTGGTAGGCAGAGG + Intronic
1165164214 19:33840153-33840175 TGGGACTCCTTAGGGAGAAGTGG + Intergenic
1165397137 19:35570656-35570678 TGGGAGACCTTGGGAAGAAGTGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166496098 19:43304395-43304417 TGGGTCTCCTGGGGAAAATGGGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167000892 19:46745580-46745602 TGGGACCCGCTGGGAAAGAGCGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926825783 2:16903772-16903794 AGGGTCTCCTTGGGAAAGATGGG + Intergenic
929943342 2:46351889-46351911 TGGGACTTCCTGGGCAGCAGGGG - Intronic
931651447 2:64472450-64472472 TGATAATCCTTGGGAAACATAGG - Intergenic
933299655 2:80527658-80527680 TGGGAGTCATTGGGAGAGAGAGG + Intronic
933725122 2:85422500-85422522 AGGGAGTCCCTGGGAAACAATGG + Intronic
938064461 2:128273530-128273552 TGGGACTCTTTAGGAGCCAGAGG + Intronic
938278457 2:130048702-130048724 TGGGACTACTGTGGGAACAGGGG - Intergenic
938329432 2:130439561-130439583 TGGGACTACTGTGGGAACAGGGG - Intergenic
938360516 2:130681942-130681964 TGGGACTACTGTGGGAACAGGGG + Intergenic
938436919 2:131288650-131288672 TGGGACTACTGTGGGAACAGGGG + Intronic
938985102 2:136567476-136567498 TCAGTCTCCTTGGCAAACAGGGG + Intergenic
941005096 2:160239803-160239825 TCAGACTCCATGGGAAAGAGAGG + Intronic
941109674 2:161405289-161405311 TGGATCACCTGGGGAAACAGAGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
944440349 2:199736919-199736941 TGGGACAGTTTGGGCAACAGGGG - Intergenic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
948242828 2:236452596-236452618 TGGCCCTCCTTGGGAAACTGAGG + Intronic
948822786 2:240558251-240558273 TGGGACACCTGAGGAAACTGAGG + Intronic
1168841388 20:912187-912209 TGGGACACCTGGGGCAACTGGGG + Intronic
1169603811 20:7292610-7292632 TTGCAATCCTTGGGAGACAGAGG + Intergenic
1170455988 20:16533222-16533244 TGGAACTCTTTGAGAAACTGAGG - Intronic
1170671633 20:18439756-18439778 TGGGCCTTCTTGTGAAACATAGG + Intronic
1170799481 20:19579177-19579199 GGGGTCTCCTTAGGAAAGAGTGG + Intronic
1171442156 20:25173829-25173851 TGGAACTCCTTGAGAAAAATAGG - Intergenic
1172385277 20:34529857-34529879 TGGGAGCCCTTGGGACACTGTGG + Intronic
1172940726 20:38652496-38652518 TGGGGCTGCTAGGGAAACTGAGG - Intergenic
1173134266 20:40425361-40425383 TTGGACTCCTTGGAGGACAGTGG + Intergenic
1176198580 20:63849180-63849202 TTTAACTCCTAGGGAAACAGAGG - Intergenic
1177263598 21:18757489-18757511 TTGGACCACTTGGGTAACAGGGG + Intergenic
1178626467 21:34222856-34222878 TGAGACTCCCTGAGAAACACTGG - Intergenic
1181957974 22:26602014-26602036 TGGGCATCCTGGGGAAAGAGAGG + Exonic
1184431674 22:44444814-44444836 TGAGACTTCATGGGTAACAGAGG - Intergenic
1184918332 22:47588522-47588544 GGGGACTCCTTGGCCAAGAGGGG - Intergenic
949526427 3:4909306-4909328 TGGCACTCCTTAGGCAACAGTGG - Intergenic
949562921 3:5219433-5219455 AGGGACCCCTTGGGAAATCGAGG + Exonic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
954331953 3:49895924-49895946 TGGACCTCCCTGGGAAACACGGG - Intronic
954359679 3:50114166-50114188 TAAGGCTCCCTGGGAAACAGAGG - Exonic
955190175 3:56754396-56754418 TGGGGCTGCTTGGTAAACTGAGG + Intronic
955909423 3:63845055-63845077 TGAGACTCCTTGAGGAACACAGG + Exonic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
958440089 3:94145959-94145981 TAAGCCTCCTTGAGAAACAGTGG + Intergenic
958482846 3:94666199-94666221 TGGGACTCTTTGGGAAGGACAGG - Intergenic
959131139 3:102357487-102357509 TGGGGATCAGTGGGAAACAGTGG + Intronic
960132713 3:114074292-114074314 AGGGACTCCTAGAAAAACAGTGG - Intronic
960209092 3:114937981-114938003 TGGGACTACTTGGGAGGCTGAGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961615956 3:128181183-128181205 TGGGGCCCCTTAGGAAACTGTGG - Intronic
962677437 3:137767380-137767402 ACCGACTCCTTTGGAAACAGCGG - Intergenic
963160732 3:142149062-142149084 TGGGACTCGTGGGGGAACAAGGG + Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966135343 3:176691895-176691917 TGGGACTTCTGGGGAAACTGAGG - Intergenic
966310364 3:178587326-178587348 TGGGAAGTGTTGGGAAACAGAGG + Intronic
966970587 3:185041899-185041921 TGGGCATGTTTGGGAAACAGTGG + Intronic
967201057 3:187072953-187072975 TGGGTGTCCGTGGGAAATAGGGG + Intronic
967353697 3:188544109-188544131 TTGGACTCCTTGAGAAATGGAGG - Intronic
968883630 4:3315278-3315300 TGGGAATCCTAGGGAATCACTGG + Intronic
969093239 4:4712630-4712652 TGGCAGTCCTTGGGCCACAGGGG + Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
972206351 4:36777718-36777740 GGGGAATGCTTGGAAAACAGAGG + Intergenic
972614482 4:40685125-40685147 TGGCCTTCCTTGGGAAAAAGTGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
974169650 4:58250210-58250232 CTGGACTCCTTGAGAGACAGGGG - Intergenic
977477912 4:97536951-97536973 TGTGACTTCTAGGAAAACAGAGG - Intronic
980402930 4:132316063-132316085 GGGGACCCCTTGGGAAAGAGGGG + Intergenic
982217742 4:153096697-153096719 TGAGAATCCTGGGGAAACAGAGG + Intergenic
982494873 4:156077971-156077993 TGGTGCTACTTGGGAAACTGAGG - Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
983151561 4:164288770-164288792 TGGGAGTCCTTTTGAAACACGGG + Intronic
984240895 4:177218289-177218311 TGGGTCTCCTTGGCCAAGAGGGG - Intergenic
987071071 5:14337603-14337625 TAGGACTACTGGGGAAAGAGGGG + Intronic
987144958 5:14982911-14982933 TGGGACCCCTTGGCCAAGAGAGG - Intergenic
988429433 5:31102183-31102205 TGGGACTCCATGTGACACAGAGG + Intergenic
988846225 5:35130862-35130884 GAGGACACCTTGGAAAACAGCGG + Intronic
989165766 5:38432381-38432403 AGGGCCTCCTTGGGAATGAGGGG + Intronic
989478907 5:41905197-41905219 TCGGACTCATAGGAAAACAGTGG + Intronic
990051806 5:51511435-51511457 TTGGCTTCCCTGGGAAACAGTGG - Intergenic
990692530 5:58379409-58379431 TGGGACTCCTTGGTTAAAACAGG + Intergenic
990745057 5:58950632-58950654 TGGGACTACTTGGGTACCAGAGG + Intergenic
991129043 5:63100295-63100317 TGGGATAATTTGGGAAACAGAGG - Intergenic
992114517 5:73526707-73526729 TGGGAAGCCTTGAGAATCAGAGG + Intergenic
992626991 5:78645219-78645241 TGGAAGTCCTTTGAAAACAGAGG + Intronic
992722491 5:79574556-79574578 TGAGACTCCATGAGAGACAGAGG + Intergenic
992762547 5:79963210-79963232 AGGGACTCCTGGGAAAACTGAGG + Intergenic
993022341 5:82606089-82606111 ATGGACTGCTTGGGAGACAGAGG + Intergenic
994606873 5:101979059-101979081 TGGGGATCCTTGAGAAACAAAGG - Intergenic
997105488 5:131014308-131014330 GGGGACTCAGTGGGAAAGAGGGG - Intergenic
999513395 5:152276457-152276479 TGGGCTTCCTTGGGGCACAGAGG - Intergenic
999873425 5:155775761-155775783 GAGGATGCCTTGGGAAACAGTGG + Intergenic
1003258832 6:4497647-4497669 TGGTACAGCTGGGGAAACAGAGG + Intergenic
1003579077 6:7322992-7323014 TCAGAATCCTTGGGAAACATGGG + Intronic
1007697527 6:43743297-43743319 TGGGCCTGCTTGGGTAGCAGGGG - Intergenic
1008351775 6:50499758-50499780 TGAGACACACTGGGAAACAGAGG - Intergenic
1008540973 6:52546215-52546237 TGTGACTCCCTGGGAAAATGAGG + Intronic
1009330312 6:62410840-62410862 TGGGACTACTTGGGAGTCTGAGG - Intergenic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015894794 6:138006994-138007016 TGGGGCTCCTTGGGAAAGATGGG - Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018195861 6:161355899-161355921 TGGGACTCGTTGGGTAAAGGGGG + Intronic
1019380633 7:720732-720754 TGAAATTCCTTGGGAAAAAGAGG - Intronic
1019953720 7:4395019-4395041 TGGGTATAGTTGGGAAACAGGGG - Intergenic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1020415410 7:7940543-7940565 TGAGAATCCTTGGAAGACAGTGG - Intronic
1022691757 7:32662798-32662820 TGTGACTCCTTGGATTACAGAGG + Intergenic
1022919371 7:34997022-34997044 TGTGACTCCTTGGATTACAGAGG + Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030820021 7:114084075-114084097 TGGAAATCCTTGGAAAACTGGGG - Intergenic
1032169265 7:129570722-129570744 TGTGAATCTTTGGGAACCAGAGG + Intergenic
1033584605 7:142764806-142764828 TGGGACTCCTTAAAAAAAAGTGG + Intergenic
1035243491 7:157547430-157547452 TGGAACTCCTTGGTACAGAGAGG + Intronic
1035456792 7:159014063-159014085 TGGGACTCCTTGGGAGACCGAGG + Intergenic
1035622877 8:1047665-1047687 TGGGACACAGTGGGACACAGTGG - Intergenic
1035859651 8:3013876-3013898 TGGGATTCCTGGGCGAACAGAGG + Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1041714400 8:60921213-60921235 TGCAAATTCTTGGGAAACAGTGG - Intergenic
1043309843 8:78844408-78844430 CTGAACTCCTTGGGAAGCAGAGG - Intergenic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1047202935 8:122781802-122781824 TCGGGCTCCGTGGGAAAGAGGGG - Exonic
1048162051 8:132030486-132030508 TTGAACCCCTTGGGAAAAAGTGG - Intronic
1048348387 8:133595588-133595610 GGGGACTCCTGGGGGAAGAGGGG + Intergenic
1048578218 8:135709601-135709623 TGACACTCCTTGGGACACTGGGG + Intergenic
1048686954 8:136915565-136915587 TGGGACTCCTTAGGAAAATGGGG - Intergenic
1048850907 8:138644489-138644511 TGGGTCTCCTTGGCCAAGAGGGG - Intronic
1049212303 8:141392320-141392342 TGGCTCGCCTGGGGAAACAGCGG - Intronic
1049304730 8:141895053-141895075 GTTGACTTCTTGGGAAACAGGGG + Intergenic
1050401601 9:5262007-5262029 TGGAACTCCTTGGGGAAAAGAGG - Intergenic
1050675581 9:8049119-8049141 GGGGACTCATTGGGGAAGAGGGG + Intergenic
1051190700 9:14508800-14508822 TAGGACTCCTTTGCTAACAGGGG - Intergenic
1052649032 9:31275730-31275752 TGGGATTCCTTGGCCAAGAGGGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053036080 9:34827584-34827606 TGGGTTTCCTTAGGAACCAGGGG + Intergenic
1053042356 9:34885409-34885431 TGGATCTCCTTAGGAACCAGGGG + Intergenic
1053160292 9:35809301-35809323 TGGGAATCATAGGGAAAGAGAGG + Intronic
1053539396 9:38958202-38958224 TGGGCCCCCTTGGCTAACAGAGG - Intergenic
1054626745 9:67405716-67405738 TGGGCCCCCTTGGCTAACAGAGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1062324023 9:136004005-136004027 TGGGGCTCCCTGGGGAACTGTGG - Intergenic
1185503836 X:618176-618198 TGTGACTCCTCTGAAAACAGGGG + Intergenic
1186157797 X:6743739-6743761 TGGCACACCTGGGGAAACTGTGG - Intergenic
1187921755 X:24210087-24210109 TAGGAGTCCTTGGCCAACAGTGG + Intronic
1190197197 X:48329566-48329588 TGGGGCTCCAGGAGAAACAGAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191647004 X:63492599-63492621 TGGGCCTCCTTGAGCTACAGTGG - Intergenic
1194088332 X:89556012-89556034 TGGGACTCCAGGAGAAAGAGAGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194456963 X:94116618-94116640 TGGGTCCCCTTGGCAAAAAGGGG + Intergenic
1196768086 X:119267940-119267962 TGGGAATCACTGGGAATCAGGGG - Intergenic
1197504469 X:127284436-127284458 GGGGACTCAGGGGGAAACAGTGG + Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1200130025 X:153836894-153836916 TGGCAGTGTTTGGGAAACAGTGG - Intergenic
1200441004 Y:3212054-3212076 TGGGACTCCAGGAGAAAGAGAGG - Intergenic
1200684552 Y:6246841-6246863 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200990081 Y:9338100-9338122 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200992743 Y:9358415-9358437 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200995396 Y:9378693-9378715 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200998061 Y:9399039-9399061 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201000571 Y:9467573-9467595 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201003237 Y:9487903-9487925 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201005894 Y:9508185-9508207 TGTGACTCTTTGGGGAACAAAGG + Intergenic
1201008551 Y:9528498-9528520 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201011133 Y:9548667-9548689 TGTGACTCTTTGGGGAACAAAGG + Intergenic
1202302964 Y:23437238-23437260 TGTGGCTCCTTGGGAAAAAGAGG - Intergenic
1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG + Intergenic