ID: 1010105800

View in Genome Browser
Species Human (GRCh38)
Location 6:72165861-72165883
Sequence CCAGTAGGATACCAGAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 194}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010105800_1010105807 -6 Left 1010105800 6:72165861-72165883 CCTGACCTCTGGTATCCTACTGG 0: 1
1: 0
2: 0
3: 5
4: 194
Right 1010105807 6:72165878-72165900 TACTGGTACCTATTATTTGGGGG 0: 1
1: 0
2: 0
3: 7
4: 110
1010105800_1010105805 -8 Left 1010105800 6:72165861-72165883 CCTGACCTCTGGTATCCTACTGG 0: 1
1: 0
2: 0
3: 5
4: 194
Right 1010105805 6:72165876-72165898 CCTACTGGTACCTATTATTTGGG 0: 1
1: 0
2: 0
3: 9
4: 96
1010105800_1010105806 -7 Left 1010105800 6:72165861-72165883 CCTGACCTCTGGTATCCTACTGG 0: 1
1: 0
2: 0
3: 5
4: 194
Right 1010105806 6:72165877-72165899 CTACTGGTACCTATTATTTGGGG 0: 1
1: 0
2: 1
3: 9
4: 95
1010105800_1010105808 0 Left 1010105800 6:72165861-72165883 CCTGACCTCTGGTATCCTACTGG 0: 1
1: 0
2: 0
3: 5
4: 194
Right 1010105808 6:72165884-72165906 TACCTATTATTTGGGGGAACTGG 0: 1
1: 0
2: 0
3: 10
4: 105
1010105800_1010105803 -9 Left 1010105800 6:72165861-72165883 CCTGACCTCTGGTATCCTACTGG 0: 1
1: 0
2: 0
3: 5
4: 194
Right 1010105803 6:72165875-72165897 TCCTACTGGTACCTATTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010105800 Original CRISPR CCAGTAGGATACCAGAGGTC AGG (reversed) Intronic
900883994 1:5402637-5402659 CCAGCAGCAGACCAGAGGACGGG - Intergenic
904132649 1:28286699-28286721 GCAGGTGGATACCTGAGGTCGGG - Intergenic
907300128 1:53481844-53481866 CCAGTAGGAGACCAGCAGGCAGG - Intergenic
907726234 1:57023343-57023365 CCAGTAACATCCCAGAGCTCTGG + Intronic
909009831 1:70322085-70322107 CAAGTAGATTACCTGAGGTCAGG + Intronic
910221038 1:84889654-84889676 CCAGTATGATGTCAGAGGACGGG + Intronic
912319876 1:108703154-108703176 CCAGTAGGTCACCTGAGGTCAGG + Intergenic
915998484 1:160590056-160590078 GCAGGTGGATACCTGAGGTCAGG - Intergenic
917119435 1:171632782-171632804 CCAGCAGATTACCTGAGGTCAGG + Intergenic
917429168 1:174947645-174947667 CAAGTAGGTCACCTGAGGTCGGG - Intronic
918371938 1:183869821-183869843 CAAGTCAGATGCCAGAGGTCTGG - Intronic
920997536 1:211009834-211009856 CGAGCAGGACACCTGAGGTCAGG - Intronic
922300563 1:224295748-224295770 CCAGTAGATCACCTGAGGTCAGG + Intronic
924402313 1:243698951-243698973 CCAGTATTATACCAGATTTCAGG + Intronic
924458288 1:244235531-244235553 CCAGTGGGTCACCTGAGGTCAGG + Intergenic
1064037011 10:11922197-11922219 CCGGCAGGAAACCTGAGGTCAGG - Intronic
1066107007 10:32165190-32165212 CCAGTTGGATTCCAGAGCACAGG - Intergenic
1067379444 10:45759589-45759611 GCAGGCGGATACCTGAGGTCAGG + Intronic
1067887146 10:50100252-50100274 GCAGGCGGATACCTGAGGTCAGG + Intronic
1068353688 10:55882773-55882795 CCAGTGGGCCACCTGAGGTCAGG + Intergenic
1068908062 10:62349222-62349244 CCAGTAGATCACCTGAGGTCAGG - Intergenic
1069535072 10:69247301-69247323 CCAGGAGGATACCAGTGGGATGG + Intronic
1071729101 10:88230330-88230352 CCAGTTGGATATCACGGGTCAGG - Intergenic
1072758582 10:98037528-98037550 CCAGTGGATTACCTGAGGTCAGG + Intergenic
1072795725 10:98353080-98353102 TCAGTAGCATTCCAGAGGTGTGG - Intergenic
1073149007 10:101299003-101299025 CCAGAAGGAAGCCAGAGGCCAGG - Intergenic
1073871576 10:107870993-107871015 CCAGTAGATCACCTGAGGTCAGG + Intergenic
1074134575 10:110615532-110615554 CCAGTAGGAAGCCCCAGGTCTGG + Intergenic
1075307881 10:121383979-121384001 CCAGTATGCCACCAGAAGTCAGG - Intergenic
1075694078 10:124420371-124420393 CCATTAGGAGGCCAGAGGCCAGG + Intergenic
1077077094 11:706766-706788 CCAGAAGGAAACCAGTGGCCGGG + Exonic
1083875047 11:65518341-65518363 CCAGCAGATTACCTGAGGTCAGG + Intergenic
1085172517 11:74461401-74461423 CCAGTGGGTCACCTGAGGTCAGG + Intronic
1086318111 11:85614411-85614433 GCAGGTGGATACCTGAGGTCAGG + Intronic
1088686399 11:112287670-112287692 CCAGTGGATTACCTGAGGTCAGG + Intergenic
1092844379 12:12570514-12570536 CCAGTCTGACACCTGAGGTCAGG + Intergenic
1093149513 12:15604478-15604500 CCAGCAGATTACCTGAGGTCAGG + Intergenic
1099482121 12:83180973-83180995 GCAGATGGATACCTGAGGTCAGG + Intergenic
1100639921 12:96472685-96472707 CCAGTGGGTCACCTGAGGTCAGG + Intergenic
1100795818 12:98180807-98180829 CCAGTAGGAAGTCAGAGGCCAGG - Intergenic
1101092623 12:101303484-101303506 CCATGAGGATACCTGCGGTCTGG + Intronic
1102988453 12:117297617-117297639 GCAGGCGGATACCTGAGGTCGGG - Intronic
1104445641 12:128831234-128831256 CCAGTAGATCACCTGAGGTCAGG + Intergenic
1104625928 12:130354642-130354664 CCTGTAAGATAGCAGAGCTCAGG - Exonic
1107333568 13:39328854-39328876 GTAGTTGGATACAAGAGGTCTGG + Intergenic
1108742353 13:53351138-53351160 CCAGTAAGATTGCAGAGGTCAGG - Intergenic
1109221445 13:59644813-59644835 CTAGTAGGAGACCACAGGGCAGG + Intergenic
1114368763 14:22061144-22061166 GCAGAAGCATACCAAAGGTCAGG + Intergenic
1114430399 14:22655909-22655931 CCAGTGGATTACCTGAGGTCAGG - Intergenic
1115198252 14:30825389-30825411 CCAGCAGATTACCTGAGGTCAGG + Intergenic
1115219071 14:31041375-31041397 GCAGGCGGATACCTGAGGTCAGG - Intronic
1117642363 14:57813360-57813382 CCAGTGGATTACCTGAGGTCAGG + Intronic
1119603505 14:75994297-75994319 CCAGTAGGATGCCTGTGGTTTGG + Intronic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1120237815 14:81912970-81912992 GCAGGTGGATACCTGAGGTCAGG + Intergenic
1125091836 15:35802078-35802100 CGGGTAGAATACCAGAGGTCAGG - Intergenic
1125287108 15:38105625-38105647 CCAGTGGGAGGCCAGAGGGCAGG - Intergenic
1127411038 15:58707153-58707175 CCAGTAGATCACCTGAGGTCAGG + Intronic
1128174694 15:65544792-65544814 CCAGCAGATCACCAGAGGTCGGG + Intronic
1131309228 15:91272682-91272704 CCGGTAGGATAGCAGGGGGCAGG + Intronic
1134052850 16:11149097-11149119 CCAGTATGTTAGCAGAGGCCAGG + Intronic
1135930519 16:26732492-26732514 CCAGTAGATCACTAGAGGTCAGG - Intergenic
1136035062 16:27532903-27532925 ACAGAAGGATACTTGAGGTCAGG + Intronic
1136510712 16:30736899-30736921 CCAGCAGGTCACCTGAGGTCAGG - Intronic
1137609739 16:49810409-49810431 CCTCTTGGATAGCAGAGGTCTGG - Intronic
1138089138 16:54159813-54159835 TCAGTATCATACTAGAGGTCAGG + Intergenic
1138329720 16:56203974-56203996 CCAGTAGGAGGCCAGAGATGAGG + Intronic
1140082188 16:71759228-71759250 GCAGGTGGATACCTGAGGTCAGG + Intronic
1141715207 16:85723029-85723051 CAAGTAGGTCACCTGAGGTCAGG + Intronic
1141772826 16:86101411-86101433 CCTGTAGGTTACCTGCGGTCCGG - Intergenic
1144521679 17:15956825-15956847 CGAGTAGAACACCTGAGGTCAGG - Intronic
1145267653 17:21388218-21388240 CCAGGAGGATGACAGAGGGCTGG - Intronic
1146388782 17:32401725-32401747 CCAGTGGATTACCTGAGGTCAGG - Intergenic
1147894894 17:43744106-43744128 CCAGGAGAATATCAGAGGCCAGG + Intergenic
1147949549 17:44099381-44099403 CCTGCAGAAAACCAGAGGTCAGG - Intronic
1148437639 17:47695537-47695559 CCCGCAGGATCCCAGAGTTCAGG - Exonic
1159690720 18:71483704-71483726 CCAGTGGATTACCTGAGGTCAGG + Intergenic
1160952322 19:1673712-1673734 CCGGCTGGATACCAGAGATCAGG - Intergenic
1162293256 19:9794494-9794516 CCAGCGGAATACCTGAGGTCAGG - Intergenic
1163003473 19:14383275-14383297 CCAGCAGATCACCAGAGGTCAGG + Intronic
1163211163 19:15841428-15841450 GCAGTAAGATCCCTGAGGTCAGG - Intergenic
1163293850 19:16399194-16399216 CCAGCAGGATTCAGGAGGTCAGG + Intronic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166254174 19:41590425-41590447 CCTGTGGTAGACCAGAGGTCAGG - Intronic
1166338855 19:42125415-42125437 CCAGGACGCTACCAGAGTTCAGG + Intronic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1167800904 19:51741091-51741113 CAGGTAGGTTACCTGAGGTCAGG - Intergenic
927207622 2:20619974-20619996 CCAGTGGGAGATTAGAGGTCTGG - Intronic
928418712 2:31120782-31120804 CCAGTGGGTCACCAGAGGTCAGG - Intronic
928667197 2:33561292-33561314 CAGGTAGAATACCTGAGGTCAGG - Intronic
929095247 2:38257582-38257604 CCAGTAGATCACCTGAGGTCAGG + Intergenic
930070794 2:47364564-47364586 CCAGTAGATTACTTGAGGTCAGG + Intronic
930177836 2:48317833-48317855 GCAGGCGGATACCTGAGGTCAGG - Intronic
930459487 2:51654231-51654253 TCAGTAGGAGACCATAGGTGTGG - Intergenic
930909844 2:56618441-56618463 CCAGCAGGCTCCCAGAGGTGAGG + Intergenic
931215501 2:60238760-60238782 CAAGTGGATTACCAGAGGTCAGG - Intergenic
931555730 2:63501841-63501863 CCAGTGGATTACCTGAGGTCAGG - Intronic
939218187 2:139267124-139267146 CCAGGAGGATGGCTGAGGTCAGG + Intergenic
939277973 2:140026393-140026415 CCAGCAGATTACCTGAGGTCAGG - Intergenic
939582219 2:143964177-143964199 CCAGTAAGATTCCAGAGGGGAGG + Intronic
941735169 2:168966120-168966142 CCAGTTAGGTAACAGAGGTCAGG + Intronic
946425882 2:219596476-219596498 CCAGCAGATCACCAGAGGTCGGG - Intergenic
1173867673 20:46322980-46323002 ACAATTGGATACCAGAGGCCGGG + Intergenic
1175451116 20:59069190-59069212 CCAGTAGGATCCCAGAATTTAGG + Intergenic
1175733955 20:61372559-61372581 CCAGGAGCAATCCAGAGGTCCGG - Intronic
1177742853 21:25174774-25174796 CCAGTGGATTACCTGAGGTCAGG - Intergenic
1178186791 21:30231392-30231414 CCAGTAAGATACAAAAGGCCAGG + Intergenic
1178820243 21:35968175-35968197 CCAGTAGATCACCCGAGGTCAGG + Intronic
1181553710 22:23655508-23655530 CCAGGTGGTTAACAGAGGTCTGG - Intergenic
1181602072 22:23958639-23958661 TCAGATGGATACCAGTGGTCCGG + Exonic
1181606438 22:23982668-23982690 TCAGATGGATACCAGTGGTCCGG - Exonic
1181625879 22:24121785-24121807 ACAGAAGGACACCAGAGGTGGGG - Intronic
1182639955 22:31759157-31759179 CCAGTGGATTACCTGAGGTCAGG - Intronic
1183915261 22:41112847-41112869 GCAGTAGGATTACAGTGGTCTGG + Intronic
1184041082 22:41944207-41944229 GCAGGCGGATACCTGAGGTCAGG + Intronic
1184266030 22:43346551-43346573 CCAGTAGGATGGCAGTCGTCAGG + Intergenic
1184456726 22:44615112-44615134 CAAGTAGGAACCCAGAGGTCTGG + Intergenic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
1184978547 22:48080344-48080366 CCAGTAGCATTCCTGAGGGCAGG + Intergenic
951927614 3:27925567-27925589 CCAGTAGGTCACTTGAGGTCAGG - Intergenic
952310282 3:32182506-32182528 CCAGTAGATCACCCGAGGTCAGG - Intergenic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
956795872 3:72718219-72718241 GCAGGTGGATACCTGAGGTCAGG - Intergenic
960775591 3:121248289-121248311 CCAGCAGATTACCTGAGGTCAGG - Intronic
961008852 3:123423103-123423125 CCAAGAGGATACAGGAGGTCTGG + Intronic
962043558 3:131732484-131732506 CCAGTAGGAGACTAGAAGACAGG + Intronic
962148112 3:132862455-132862477 CCAGTAAGATATGAGAGTTCTGG + Intergenic
966469679 3:180275023-180275045 CCAGTAGGATACTGGAGATTTGG - Intergenic
976638578 4:87312830-87312852 CAGGTAGGACACCTGAGGTCAGG + Intronic
977149801 4:93496548-93496570 ACAGTAAGTTACCAGAGGTTGGG - Intronic
978607024 4:110491946-110491968 CCAGTGGGTCACCTGAGGTCAGG - Intronic
982515945 4:156349229-156349251 CCAATAGGGTAACAGAGGTAGGG - Intergenic
985408614 4:189660972-189660994 CCAGAAGGAAACCAGATGCCAGG + Intergenic
986808782 5:11333860-11333882 CCAGTAGGATGCCATAGGGGTGG - Intronic
986992722 5:13572413-13572435 CCAGAAGAATTCCAGATGTCAGG - Intergenic
987339624 5:16928419-16928441 GCAGGTGGATACCTGAGGTCAGG - Intronic
990361859 5:55029005-55029027 CCAGTAGATCACCTGAGGTCAGG + Intronic
990744596 5:58946832-58946854 CCAGTGGATTACCTGAGGTCAGG - Intergenic
992586239 5:78243330-78243352 GGAGTAGGATACCATAGGACAGG - Intronic
993509489 5:88754112-88754134 CCAGTGGGAAGCCAGAGGGCAGG - Intronic
996684752 5:126268098-126268120 TTTGTAGGTTACCAGAGGTCAGG - Intergenic
996858825 5:128041551-128041573 CCATTAAGATACTAGAGGCCTGG + Intergenic
1000714366 5:164622473-164622495 CCAGTGGATTACCTGAGGTCAGG + Intergenic
1002838909 6:888957-888979 CAAGTTGGATAGCAGAGGTAGGG - Intergenic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1007182202 6:39937487-39937509 CCACCTGGAAACCAGAGGTCAGG - Intergenic
1010105800 6:72165861-72165883 CCAGTAGGATACCAGAGGTCAGG - Intronic
1012444254 6:99292103-99292125 CAAGAAGGTTCCCAGAGGTCTGG - Intronic
1015208736 6:130671755-130671777 CCAGTTTGTTGCCAGAGGTCGGG + Intergenic
1015392353 6:132696874-132696896 CCAGTGGAACACCTGAGGTCAGG + Intronic
1015846383 6:137524779-137524801 CCAGTGGATTACCTGAGGTCAGG + Intergenic
1016355308 6:143211937-143211959 CAAGTAGGATACCACAGGAAAGG - Intronic
1018002950 6:159595886-159595908 GCAGTAGGTCACCTGAGGTCAGG - Intergenic
1020600679 7:10270917-10270939 CCAGTAGGCTACTCGGGGTCAGG - Intergenic
1021346014 7:19529399-19529421 CCAGTAGATCACCTGAGGTCAGG - Intergenic
1022262332 7:28718509-28718531 TCAGTTAGATAACAGAGGTCAGG + Intronic
1022773506 7:33500391-33500413 CCAGTAGGAAATCAGAAGACAGG + Intronic
1022834981 7:34104752-34104774 CCAGTTTGTTACCAGAGGCCAGG - Intronic
1022922213 7:35026966-35026988 GCAGGTGGATACCTGAGGTCAGG + Intronic
1023805921 7:43872974-43872996 CCAGAAGGAGAACAGAGGTGGGG - Intronic
1024518968 7:50285928-50285950 CCAGTGAGATCCCAGAGGACAGG - Intergenic
1025899503 7:65732351-65732373 ACAGGTGGATACCTGAGGTCAGG + Intergenic
1026207999 7:68275731-68275753 CCAGTGGATCACCAGAGGTCAGG - Intergenic
1028226768 7:88261096-88261118 CCAGTAGGAAACCTGGGGCCAGG - Intergenic
1031167760 7:118250344-118250366 CCAGTTGGATACTAGTGGTGGGG + Intergenic
1033162598 7:139010770-139010792 GCAGGCGGATACCTGAGGTCAGG + Intergenic
1036696319 8:10977331-10977353 CCAGTTGGCCACCAGAGGGCAGG - Intronic
1036988715 8:13567135-13567157 CCAGTTTGCTCCCAGAGGTCAGG - Exonic
1038972913 8:32657470-32657492 CCAGTGAGAAACCACAGGTCTGG - Intronic
1039043885 8:33433004-33433026 CAAGTAGAACACCTGAGGTCAGG + Intronic
1040008452 8:42640819-42640841 CCAGCTGGAAACCAGAGGGCAGG + Intergenic
1041681111 8:60592955-60592977 CCGTAAGGATAACAGAGGTCAGG + Intronic
1043483796 8:80679045-80679067 CCAGAAGGTTACCAGAACTCTGG - Intronic
1043650054 8:82579473-82579495 CCAGTATGATAACAGTGGGCTGG - Intergenic
1044224180 8:89701033-89701055 CAGCTAGGATTCCAGAGGTCTGG + Intergenic
1045690242 8:104752870-104752892 CCAGGGGGATATCAGGGGTCAGG + Intronic
1045999502 8:108402252-108402274 CCAGGAAGATACCAGAGGCTAGG + Intronic
1046438837 8:114231547-114231569 CCAGTGGAACACCTGAGGTCAGG + Intergenic
1047739997 8:127798629-127798651 CCGGTAGATTACCTGAGGTCAGG + Intergenic
1049256761 8:141618329-141618351 CCAGAAGGCAAGCAGAGGTCTGG - Intergenic
1050134033 9:2442508-2442530 GCAGGTGGATACCTGAGGTCAGG - Intergenic
1050689409 9:8208541-8208563 CCTGTAGAATGCAAGAGGTCAGG + Intergenic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1055121160 9:72662422-72662444 CCAGTGGATTACCTGAGGTCAGG - Intronic
1057005373 9:91553030-91553052 GCAGGAGGACACCTGAGGTCAGG + Intergenic
1059683070 9:116605223-116605245 CCAGTAGGCTCCCAGATGCCAGG + Intronic
1061131952 9:128713360-128713382 CCAGTGGGATGACAAAGGTCTGG - Exonic
1061446783 9:130643256-130643278 CACTTAGGATACCAGAGGTTAGG - Intergenic
1185800380 X:3005274-3005296 CAAGTGGAATACCTGAGGTCAGG - Intergenic
1188708081 X:33359897-33359919 CCGGTAGATTACCTGAGGTCAGG + Intergenic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1192553799 X:72074093-72074115 CCAGCATGATACCAGTCGTCTGG - Intergenic
1193949062 X:87775739-87775761 CCAGCAGATCACCAGAGGTCAGG - Intergenic
1194765035 X:97839615-97839637 CCAGTAATATACCAGAGATTAGG + Intergenic
1195800269 X:108700942-108700964 CCAGCAGAATACCAGAGGAGGGG + Intergenic
1197043236 X:121965341-121965363 CCAGCAGGAGACCAGAGAACTGG - Intergenic
1197819731 X:130531060-130531082 CCAGTAGGGTTCCAGAGCACGGG - Intergenic
1199503642 X:148537205-148537227 CCAGGAGCATACAAGAGGTTTGG + Intronic