ID: 1010106388

View in Genome Browser
Species Human (GRCh38)
Location 6:72174117-72174139
Sequence CTCAAATCACAGATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 327}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010106388 Original CRISPR CTCAAATCACAGATGGAGGA GGG (reversed) Intronic
900501197 1:3005502-3005524 CTCAAACCTGGGATGGAGGATGG + Intergenic
900864505 1:5258211-5258233 TTCAAATCAGAGATGGATGTTGG + Intergenic
901539968 1:9909679-9909701 ATCAAACTACAGAGGGAGGAAGG + Intronic
902532560 1:17099633-17099655 CCCAAATCCCAGAAGGAAGAAGG + Intronic
905421796 1:37851717-37851739 CAGTAATCACTGATGGAGGATGG + Intronic
906370289 1:45247925-45247947 CTCACATCACAGATGATGGGCGG - Intronic
907842316 1:58169885-58169907 TTCAAATCAGAGAGGGAGAAGGG - Intronic
908439348 1:64137962-64137984 CTCATTTCACAGATGAAGAAGGG - Intronic
909707477 1:78604673-78604695 CTCTAATCTCACATGGTGGAAGG - Intergenic
910079539 1:83325234-83325256 CCCAAATTACAGAATGAGGAGGG + Intergenic
911184365 1:94888402-94888424 CTCAAAGCACATCTGTAGGATGG - Intronic
911569848 1:99508615-99508637 CTCACATCCCAGATGAAGGGTGG - Intergenic
911671199 1:100610195-100610217 CTCAAAGCAGTGATGGAGGAAGG - Intergenic
911751386 1:101501120-101501142 TTTAAATCAGAGAGGGAGGAGGG - Intergenic
912378540 1:109233091-109233113 CTCAAGTCACATATGGCTGATGG - Intronic
912498820 1:110108405-110108427 CTCAAATCACATTTGGAGCCTGG - Intergenic
913469488 1:119174544-119174566 TTTAAATCACAGAGGGAGAAGGG - Intergenic
914395309 1:147261334-147261356 CTCACATGACAGAAGGTGGACGG + Intronic
914947336 1:152079106-152079128 CTCAATTCCCAGATGGTGGGTGG + Intergenic
915612200 1:157003365-157003387 CTCAGATCACAAATTCAGGAGGG + Intronic
915951601 1:160193095-160193117 CTCAAATCCCAGAAAGAGGTGGG + Intronic
915970401 1:160351148-160351170 CTTACATCCCAGAAGGAGGAGGG - Intronic
916802469 1:168227282-168227304 CTCATTTCACAGATGGGGAACGG - Intronic
917801374 1:178573559-178573581 TTCAAACCACAGATAGAGCAGGG - Intergenic
918615431 1:186539104-186539126 CTCAAATCACAGAAGGAATGGGG + Intergenic
919051085 1:192512399-192512421 CACAAATTAGAGATGGAGGAAGG - Intergenic
919111811 1:193229464-193229486 CTCCTATCACAGAAGGAGCAAGG - Intronic
919468261 1:197948316-197948338 CCCAAAACAAAGATGCAGGAAGG + Intergenic
919980476 1:202639882-202639904 CTCAAATTACAGGAGGAGCAGGG - Intronic
920382735 1:205545034-205545056 CTCACATCCCAGATGGTGGGCGG + Intergenic
921019673 1:211224434-211224456 TTTAAATCACAGAGGGAGAAGGG - Intergenic
922015668 1:221644189-221644211 CTCAAATCACAGAAATAGGCTGG - Intergenic
924465491 1:244295724-244295746 AACAAATCTCAGATGGAGGGAGG + Intergenic
1063283560 10:4659138-4659160 ATCAAATAACAGATAGATGAAGG - Intergenic
1063910515 10:10825130-10825152 CTCAAATCAGACAGGGAGGCTGG - Intergenic
1063953437 10:11244892-11244914 CACCAGACACAGATGGAGGAAGG - Intronic
1065441858 10:25761316-25761338 CTGAAATTACAGATGGAGGCTGG + Intergenic
1065737979 10:28771623-28771645 CTCACATCTCAGATGATGGACGG - Intergenic
1065806536 10:29398369-29398391 CTCAGAGCACAGAAGGAGGACGG - Intergenic
1068500288 10:57834927-57834949 TTTAAATCAGAGATGGAGAAGGG - Intergenic
1070665490 10:78339557-78339579 CTCAAATCACAGAGGGACCTTGG + Intergenic
1072494666 10:95945026-95945048 CTCACATGGCAGATGGTGGAAGG - Intergenic
1072685988 10:97537291-97537313 GTCAAATGACAGCTGGAGGTGGG - Intronic
1074163176 10:110851145-110851167 CTCAAACCACAGAAGAAGGGCGG - Intergenic
1075605430 10:123802027-123802049 AGCATCTCACAGATGGAGGAAGG + Intronic
1078583283 11:12557134-12557156 CTCAAATCAATGATAGAGGCAGG + Intergenic
1078707680 11:13760750-13760772 CTAAAATCACAGTTTGAGCAAGG + Intergenic
1079050623 11:17154827-17154849 CCCAAATAGCAGATAGAGGAAGG - Intronic
1079635638 11:22737263-22737285 CTAAAATCACTGTTGGAGGTAGG + Intronic
1080562797 11:33479317-33479339 GGCCAATCACAGATGAAGGAAGG - Intergenic
1081071510 11:38616038-38616060 CTAAGATCACTGATGGAGGTGGG - Intergenic
1081861380 11:46335015-46335037 GACAAATCACAAATGGAGGCTGG + Intronic
1084438153 11:69156001-69156023 GGCACACCACAGATGGAGGAAGG + Intergenic
1084970625 11:72769850-72769872 CGCACATCACAGAGGGTGGAGGG + Intronic
1085057020 11:73410967-73410989 CTCAGCTCACAGACTGAGGAAGG + Intronic
1087100339 11:94357657-94357679 CACAAATCTCAGTTGAAGGACGG + Intergenic
1088217614 11:107530207-107530229 CTTAAATCAAAGGTGGAAGACGG - Intronic
1088523620 11:110727483-110727505 ATCAAACCACAGATCCAGGAAGG - Intergenic
1090268704 11:125370924-125370946 CTAGAACCACAGATGAAGGAAGG + Intronic
1090908218 11:131095941-131095963 AACAAATCACAGATGCACGAGGG + Intergenic
1091754572 12:3043084-3043106 GCCAGATCACAGATGGAAGACGG - Intergenic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1092351575 12:7760274-7760296 TTCAAATCTCAAATGGAAGAAGG - Intergenic
1095204162 12:39420350-39420372 CTCTCATCACAGATGTAGCAAGG + Intronic
1095705808 12:45235872-45235894 CCCAGCTCACAGCTGGAGGAAGG - Intronic
1095774925 12:46000502-46000524 CTCACATCCCAGATGATGGATGG - Intergenic
1096536079 12:52275691-52275713 CCCATTTCACAGATGGAGAAAGG + Intronic
1096563309 12:52452330-52452352 CTCAAGTCAAAGCTGGAGGCAGG - Intergenic
1096753757 12:53781594-53781616 CTGACATCACAGATGGTGCAGGG + Intergenic
1098180586 12:67841936-67841958 CCCAAATTCCAGATTGAGGAAGG + Intergenic
1099506168 12:83478936-83478958 CTCAAAGCACACATGGAGACAGG - Intergenic
1100572814 12:95858900-95858922 GTCCAATCACAGAGGCAGGAAGG + Intergenic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1101411744 12:104474572-104474594 CTCAAATCTCATTTGCAGGAAGG - Intronic
1102030560 12:109737881-109737903 CTCAGAACAGAGATGGGGGAGGG + Intronic
1103290989 12:119846080-119846102 CTCAAATCACATCTTCAGGAGGG - Intronic
1107290497 13:38847536-38847558 TTCAAATCACAGATGAGGGGAGG + Intronic
1108116356 13:47132830-47132852 CTCAAGTCACAGCTGGAAGGTGG + Intergenic
1108505970 13:51112714-51112736 ATCAATTCACAGATGAAGAAGGG + Intergenic
1109119289 13:58433742-58433764 CTCACATGGCAGAAGGAGGAAGG + Intergenic
1109622950 13:64932904-64932926 CGCAAATCACAGCTGAAGAAGGG - Intergenic
1109967289 13:69717029-69717051 CTCAAATCAGAGAAGGTAGAAGG - Intronic
1113862730 13:113500272-113500294 CTCAAATCACAGATAATGTACGG - Intronic
1113971365 13:114193482-114193504 CTCATATGGCAGATGGTGGAAGG + Intergenic
1115952407 14:38736067-38736089 TACAAATCCCAGATGGAAGAGGG + Intergenic
1119137763 14:72236658-72236680 CTCACATCCCAGACGGTGGAGGG + Intronic
1119967846 14:78936868-78936890 CTCTCATCAAAGATGTAGGATGG + Intronic
1120198779 14:81515229-81515251 TTTAAATCAGAGAGGGAGGAGGG - Intronic
1121874660 14:97440258-97440280 TTCAAATCCCAAATGGAGGTGGG - Intergenic
1121996735 14:98608535-98608557 CTCAGAGCACAGTGGGAGGAGGG + Intergenic
1122391592 14:101391823-101391845 CTAAAATCACAGAAAGAGAAGGG - Intergenic
1124529409 15:30491316-30491338 CTCAAATGACAGATCAAGGCAGG + Intergenic
1124653981 15:31493970-31493992 CTCAAAGCAGAGAGGGAGGAGGG + Intronic
1125097352 15:35870256-35870278 GTCAAAGCACAGATGGGGGAGGG - Intergenic
1126473249 15:49039133-49039155 CTCAAATCAGGTAGGGAGGAAGG - Intronic
1128309137 15:66619748-66619770 CTCAAATCACATTTGGATGTTGG - Intronic
1128931734 15:71710421-71710443 AGCAAATCCCAAATGGAGGAGGG + Intronic
1129136008 15:73552255-73552277 CACAAATTATAGATGGAGAAGGG - Intronic
1131627265 15:94134639-94134661 CGCAAATCACACATGAAGCAAGG - Intergenic
1132199005 15:99935084-99935106 CCCAAATCACCCATGAAGGAAGG - Intergenic
1133199066 16:4191314-4191336 CTCAAAACCCAGGTGGAGGCCGG + Exonic
1134427129 16:14160570-14160592 TTCAAATCACAGATGAAAGGAGG - Intronic
1135959479 16:26983793-26983815 CCCAAAGCACAGAGGCAGGAAGG - Intergenic
1137687866 16:50399417-50399439 CTGTAATGACAGATGGTGGAGGG + Intergenic
1137901236 16:52271564-52271586 ATGACATCACAGAAGGAGGATGG + Intergenic
1139823734 16:69740755-69740777 TTAAAAGCACAGATGGAGGCCGG + Intergenic
1140697684 16:77551118-77551140 CTCCGATCACAGATGAAGAAAGG + Intergenic
1141084919 16:81086659-81086681 CTCAAATCAGAGAAGGAAAAAGG + Intronic
1141475915 16:84273262-84273284 TTCAAATATCAGATGGATGATGG - Intergenic
1142319150 16:89369954-89369976 CTCAAACCCCAGCTGCAGGATGG + Intronic
1143025054 17:3936593-3936615 TTCACATCACAGCTGGCGGAGGG - Intronic
1143373482 17:6454517-6454539 CTCCAATAACAGAAGGAAGACGG + Exonic
1144139024 17:12329234-12329256 CCAAAATCACAGATAGAGAAGGG - Intergenic
1146453778 17:32994368-32994390 CCAAAATCAGAGATGGAGCAAGG + Intronic
1146667837 17:34716587-34716609 CCCAAGTAACAGATGGAAGAAGG - Intergenic
1147777208 17:42910786-42910808 ATTAAATCACAGATGGCAGATGG - Intronic
1148200984 17:45749904-45749926 CTCAGATCCCAGTGGGAGGAAGG + Intergenic
1149252989 17:54791609-54791631 CTCATATCACAGAAGGTGGTAGG - Intergenic
1149729025 17:58925992-58926014 CACAATTCCCAGTTGGAGGAGGG - Intronic
1150907971 17:69358909-69358931 CTCACATGACAGAGGGGGGAAGG - Intergenic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1153132861 18:1877382-1877404 CTCACATGACAGAAGGGGGAAGG - Intergenic
1153711052 18:7799212-7799234 CTCACATGGCAGAAGGAGGAAGG + Intronic
1153981652 18:10315503-10315525 CTCAGAGCAGAGATGGATGAAGG - Intergenic
1154506914 18:15050118-15050140 CACAAAGTACAGATGGAGCATGG + Intergenic
1155062584 18:22241852-22241874 CACAAATCACGGATGGAACAAGG + Intergenic
1155272403 18:24153380-24153402 CTCACATGAAAGATGGAGGCAGG - Intronic
1155698565 18:28714773-28714795 CTCAAAGCACAGTTGGAAAAAGG + Intergenic
1156227280 18:35121751-35121773 GTCAAATCACTGATGGAGTGGGG + Intronic
1156617827 18:38808999-38809021 CTCCAACCACAGATGCTGGATGG + Intergenic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1159719891 18:71875451-71875473 ATAAAAACACATATGGAGGACGG + Intergenic
1159794214 18:72822228-72822250 CTCAAGTCTCAGAGGGTGGAGGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161566845 19:5007134-5007156 CTCAAATGGGAGATGGAGGTTGG - Intronic
1162081852 19:8222831-8222853 CTCACAGCACAGGTGGAAGACGG + Intronic
1162810212 19:13159777-13159799 CTCAAACCTCAGATGGTTGAGGG + Intergenic
1163788548 19:19291385-19291407 CTAAAATCAGAAATGAAGGAGGG + Intronic
1164034855 19:21443980-21444002 CTCACATCCCAGATGATGGACGG + Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165296456 19:34930248-34930270 ATCAAACCACAGATGGATGTAGG - Intronic
1165600083 19:37047342-37047364 CTCACATGGCAGAAGGAGGAAGG - Intronic
1165847063 19:38824948-38824970 TTTAAATCAGAGATGGAGAAGGG - Intronic
1167278012 19:48550487-48550509 CTCACCTAACAGATGCAGGAAGG - Intergenic
925665565 2:6251755-6251777 CTCACATCACAGATGGGGACAGG + Intergenic
928350117 2:30543861-30543883 CTAAAAACACAGATTGATGAGGG - Intronic
929178820 2:39010586-39010608 CTCAAACCACAGAGTGAGGTTGG + Exonic
929856978 2:45645815-45645837 CTCAAATGACAGGTGCAGAAAGG - Intergenic
929873819 2:45779527-45779549 CTCAGTTCACAAATGGAGCAAGG - Intronic
935339228 2:102045048-102045070 CTCACATCAAGGATGGGGGAGGG + Intergenic
936637808 2:114278990-114279012 ATCAAGTCAGAGATGGAGGTGGG + Intergenic
936841576 2:116776036-116776058 CTCAAATTAGAGATGTAGGCCGG + Intergenic
937055410 2:118930907-118930929 CTCACATGGCAGATGGTGGAAGG + Intergenic
937249945 2:120517279-120517301 CCCATTTCACAGATGGGGGAAGG + Intergenic
938667489 2:133553615-133553637 GCCAAATCACAGAAGCAGGAAGG + Intronic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
940418435 2:153449792-153449814 CTCACATGACAGAAGGTGGAAGG + Intergenic
940631419 2:156244330-156244352 ATCAAATCAAAGATTGGGGAAGG - Intergenic
940717968 2:157249346-157249368 CTCAAAACATTGAGGGAGGAAGG - Intergenic
940805936 2:158186479-158186501 CTCAAGTCACAGATTGAGTAAGG - Intronic
940939335 2:159540013-159540035 CTCCAAACAGGGATGGAGGAAGG - Intronic
941857233 2:170243387-170243409 TTCTAAGCACAGATAGAGGAAGG + Intronic
943198017 2:184780531-184780553 CCTTAATCACAGATGGAGGGAGG + Intronic
943655989 2:190509638-190509660 CTCAAATTAAAGATGGAAGGGGG - Intronic
943686137 2:190820081-190820103 CTCAAATCACAGCTGTTGAATGG + Intergenic
943763892 2:191639475-191639497 CTGGAATCATACATGGAGGATGG + Intergenic
945718191 2:213384460-213384482 CTCAAATCTAAGATGGTGGAGGG + Intronic
945985678 2:216351761-216351783 CTCATCTCAAAGATGAAGGAAGG + Intronic
946184094 2:217967469-217967491 CTCAAATCACAAGTGAAAGAGGG + Intronic
946537082 2:220642714-220642736 CTCAAATGCCAGAATGAGGAGGG - Intergenic
947254612 2:228148299-228148321 CTCAAATGTCAAAAGGAGGATGG - Intronic
947942733 2:234072686-234072708 CTGAAATCACAGAATGAGGCTGG + Intronic
948088234 2:235268102-235268124 CTCAAAGCAGAGATGGACGTGGG - Intergenic
948584227 2:239009014-239009036 GGAAAATCACAGATGGAGGAAGG - Intergenic
948720661 2:239898087-239898109 CCCAGCTCACAGATGGAGCAAGG + Intronic
1170788951 20:19491893-19491915 AACTAATCACTGATGGAGGAAGG - Intronic
1171213841 20:23337351-23337373 CTCAGATCCCAGATAAAGGATGG - Intergenic
1172583326 20:36065197-36065219 CGCCAAGCACAGATGGAGGCTGG - Intergenic
1174111025 20:48197887-48197909 CTCAAATCACAGAATGATGAAGG + Intergenic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1176697705 21:10000699-10000721 CTCATTTCAAAAATGGAGGAAGG - Intergenic
1176984534 21:15420785-15420807 CTCAGGTCACTGAGGGAGGATGG + Intergenic
1177054932 21:16290094-16290116 CTCAAATCACACATTGAAAAAGG + Intergenic
1177135037 21:17299014-17299036 TTTAAATCAGAGAGGGAGGAGGG - Intergenic
1177522455 21:22244592-22244614 CTCAAATTACACATGAAAGAGGG + Intergenic
1179081882 21:38178977-38178999 CTGAAAGGAAAGATGGAGGATGG - Intronic
1180832866 22:18914929-18914951 CCCAGATCACAGACGCAGGAGGG + Intronic
1181066956 22:20311323-20311345 CCCAGATCACAGACGCAGGAGGG - Intergenic
1182149524 22:28018410-28018432 CTCAAATCACGGTTGCAGGTTGG - Intronic
1182869255 22:33632026-33632048 CACAAAGTCCAGATGGAGGATGG + Intronic
1183374450 22:37454823-37454845 CGGACATCACAGAGGGAGGAAGG - Intergenic
1184105527 22:42365538-42365560 CGCAGGTCACAGATGGAGCAGGG + Intergenic
1184301609 22:43564046-43564068 CCCATTTCTCAGATGGAGGACGG - Intronic
1184878617 22:47291130-47291152 CTCAAATGAAAGATGAAGGCTGG + Intergenic
1184882119 22:47314356-47314378 CACAAAGGACAGAAGGAGGAAGG - Intergenic
1203282951 22_KI270734v1_random:140233-140255 CCCAGATCACAGACGCAGGAGGG + Intergenic
949429299 3:3956896-3956918 CTAAGATTACAGTTGGAGGAAGG - Intronic
949625607 3:5863302-5863324 GTCAGATCTCAGATGGAAGAGGG + Intergenic
949885465 3:8689732-8689754 CTCAAAGCCAAGATTGAGGACGG - Intronic
950383527 3:12637573-12637595 CTTAAAACACAAATGGAGGCCGG + Intronic
950426557 3:12927630-12927652 CTCAGAGCACAGAGGGAAGAGGG + Intronic
952439960 3:33316697-33316719 CTCAAAATACAGGTGGATGAGGG - Intronic
952601045 3:35083541-35083563 CTTAAATCAGAGATGAAGTATGG - Intergenic
953175717 3:40550311-40550333 CTCAAATACCAGTTGGAGGAGGG - Intronic
953559291 3:43972110-43972132 CTCCACTCAGAGATGGGGGAAGG + Intergenic
953622973 3:44548684-44548706 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954792977 3:53146480-53146502 CTCAAGTCTCGGATGGAGGCGGG + Intergenic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
955877872 3:63512639-63512661 CTGAATTCAAAGCTGGAGGAAGG + Intronic
956192124 3:66618059-66618081 CCCAAATCACATTTGGAGTATGG + Intergenic
956663110 3:71618483-71618505 CTCTAGTCACAGATGGATCATGG - Intergenic
957043521 3:75355892-75355914 CTCAAAGCCAAGATTGAGGATGG + Intergenic
957788994 3:84916540-84916562 CTCAGATCACAGTTGAAAGATGG - Intergenic
957903168 3:86523728-86523750 CTGAATTCGAAGATGGAGGATGG - Intergenic
959575922 3:107933630-107933652 ATCAAAGCAGAGGTGGAGGAAGG - Intergenic
961334766 3:126166264-126166286 CACAAATCAGACATGGAGAAGGG - Intronic
961791864 3:129382086-129382108 CTAGAACCTCAGATGGAGGAAGG + Intergenic
961805887 3:129489045-129489067 CTAGAACCTCAGATGGAGGAAGG + Intronic
962206515 3:133439449-133439471 CACAAATCAGTGATGGAGAAAGG + Intronic
964064465 3:152562047-152562069 CTTAAATCAGAGAGGGAGAAGGG - Intergenic
966721965 3:183072382-183072404 CTCTAATTGCAGATGGAGGAGGG + Exonic
969027073 4:4182248-4182270 CTCAAAGCCAAGATTGAGGACGG + Intergenic
969938822 4:10709898-10709920 CTGACATCACTGATGCAGGAGGG + Intergenic
971552423 4:27974600-27974622 GTTAAATCACAGAGGGAGGAAGG - Intergenic
972186668 4:36536649-36536671 CCCATATCACAAATGAAGGAGGG - Intergenic
972218878 4:36930166-36930188 TTCAAATCTCTAATGGAGGATGG - Intergenic
973206725 4:47569299-47569321 CTCAAATAGGTGATGGAGGAAGG - Intronic
976639591 4:87323949-87323971 CTCAAGTGGCAGAAGGAGGAAGG + Intergenic
977540068 4:98306364-98306386 CTCACATGACAGAAGGTGGAAGG + Intronic
978099138 4:104815269-104815291 CTCACATGACAGAAGGTGGAAGG - Intergenic
978315405 4:107430343-107430365 CTCAGAGCAAAGATGGAGCAAGG + Intergenic
981356238 4:143792530-143792552 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981377556 4:144033412-144033434 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981476997 4:145197106-145197128 CACACATCCCAGCTGGAGGAGGG - Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG + Intergenic
985819872 5:2152366-2152388 CTCATTGCACAGATGGAAGATGG + Intergenic
985819875 5:2152401-2152423 CTCATTGCACAGATGGAAGATGG + Intergenic
985819878 5:2152436-2152458 CTCACTGCACAGATGGAAGATGG + Intergenic
985819881 5:2152471-2152493 CTCACTGCACAGATGGAAGATGG + Intergenic
985819884 5:2152506-2152528 CTCACTGCACAGATGGAAGATGG + Intergenic
985819887 5:2152541-2152563 CTCACTGCACAGATGGAAGATGG + Intergenic
985819890 5:2152576-2152598 CTCACTGCACAGATGGAAGATGG + Intergenic
986166655 5:5278420-5278442 CTCTAATCACATAAGCAGGACGG - Intronic
987146829 5:14999560-14999582 CTCAATTCACAGTAGCAGGATGG + Intergenic
987545286 5:19305085-19305107 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG + Intergenic
989985191 5:50689134-50689156 CTCAAATAACAGGTGGATTAAGG - Intronic
990512324 5:56499948-56499970 TTCAAATCCCAAATGGAGGTTGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992867586 5:80973345-80973367 CTCAGATCACAGGAGGATGAGGG - Intronic
993237920 5:85338702-85338724 CTCAAATCAAAGATGCACAAAGG + Intergenic
993265070 5:85716238-85716260 CTCAAAACACAGATGGAAACAGG - Intergenic
994665930 5:102705237-102705259 CTCATATGGCAGAAGGAGGAAGG - Intergenic
996050911 5:118932232-118932254 CTCTAATCCCAGAGGCAGGAGGG + Intronic
996057648 5:118998946-118998968 CTCACATCACAGATGATGGGCGG - Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996294542 5:121896105-121896127 CTCAAAACACAGATAAGGGAAGG + Intergenic
997260741 5:132463996-132464018 CTCCAACACCAGATGGAGGAGGG + Exonic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
998200143 5:140113007-140113029 CCCAAATCTCAGAAGGAGGAGGG + Intronic
998322250 5:141243298-141243320 TTGAAATCACAGAGGGAGGTGGG - Intergenic
998354354 5:141522383-141522405 CAGAACTCACAGGTGGAGGAAGG - Intronic
1000382183 5:160639070-160639092 CACAAAGCACAGAGGCAGGAAGG - Intronic
1000989131 5:167894168-167894190 CAAAAATCACAGATGATGGATGG + Intronic
1002050292 5:176566700-176566722 TTCCAGTCACAGAAGGAGGAAGG + Intronic
1002102923 5:176866241-176866263 CTCACATCAAAGATGGGGTAGGG + Intronic
1002870282 6:1160865-1160887 CTCAAATCACACATGGACACAGG - Intergenic
1003701394 6:8468903-8468925 ATCAAATCTGAGATGGAAGAGGG - Intergenic
1004355074 6:14923541-14923563 CTTAAATCACAAAGGGAAGAAGG + Intergenic
1004371763 6:15058943-15058965 CTCAAATGTCAGAAGGAGCAAGG + Intergenic
1006091092 6:31629493-31629515 CTCAAAGCACACATGGACAAAGG - Intronic
1006722949 6:36171616-36171638 CTCAAATTCCAGAATGAGGAGGG + Intergenic
1007861095 6:44909677-44909699 CTCACATTACAGATGGAGAGAGG + Intronic
1010106388 6:72174117-72174139 CTCAAATCACAGATGGAGGAGGG - Intronic
1011736894 6:90319842-90319864 TTTAAATTAGAGATGGAGGATGG - Intergenic
1012492131 6:99793681-99793703 GGCAGATGACAGATGGAGGATGG + Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013907896 6:115238908-115238930 TTTAAATCACAGAGGGAGAAGGG + Intergenic
1014074915 6:117224762-117224784 CTCATATGGCAGATGGTGGAAGG - Intergenic
1016086971 6:139926367-139926389 CACAAAACGCAGATGGAAGAGGG - Intergenic
1017346546 6:153390025-153390047 CTCAAATCACATATCTAGAAAGG - Intergenic
1018154307 6:160971389-160971411 CTCAAAACACACAGGGAGGTAGG + Intergenic
1018406837 6:163494296-163494318 CTCAAGTCACTGATATAGGAAGG - Intronic
1018857753 6:167687681-167687703 CGCAGATCACAGGTGGAGGGAGG - Intergenic
1020542022 7:9470383-9470405 CTCCCATCACAGACGTAGGAGGG + Intergenic
1022195920 7:28067252-28067274 CTCACAACACTGATGGAGCAAGG - Intronic
1022600343 7:31752255-31752277 CTAAAATCACAGAAGTAGCAAGG - Exonic
1022825666 7:34010252-34010274 CTCAAACTACATATAGAGGAAGG - Intronic
1024371112 7:48585001-48585023 CTCATATGAGAGATGAAGGAAGG - Intronic
1024653704 7:51431299-51431321 CTCAAATCAGAGAGACAGGATGG - Intergenic
1026235807 7:68526294-68526316 CTCCAATAACTTATGGAGGAAGG + Intergenic
1026534929 7:71231661-71231683 CTCACATGACAGATAGAGCAAGG + Intronic
1027297300 7:76790522-76790544 CCCAAATTACAGAATGAGGAGGG + Intergenic
1028535798 7:91888214-91888236 CTCACATCACAGATGATGGGCGG - Intergenic
1028535952 7:91888783-91888805 CTCACATCACAGATGATGGGCGG - Intergenic
1028535981 7:91888898-91888920 CTCACATCACAGATGATGGGTGG - Intergenic
1029029698 7:97454587-97454609 CTCATATCACAGAAGGGGCAAGG - Intergenic
1029077413 7:97946384-97946406 CTCAAAACCAAGATTGAGGAAGG + Intergenic
1029610707 7:101625207-101625229 CTGACATCACAGAGGCAGGAAGG - Intronic
1030975371 7:116115481-116115503 CACACTTCAAAGATGGAGGAAGG - Intronic
1031971590 7:128068649-128068671 CTGAAATCAAACATGGAGGAAGG - Intronic
1034221647 7:149451067-149451089 CTCATGTCACAGATGGAGCGCGG - Exonic
1035656446 8:1310411-1310433 CTCTAATCATAGCTGGAGGCTGG + Intergenic
1036591233 8:10170360-10170382 CTCACATCACAGAAGGCGCAAGG - Intronic
1037089255 8:14893229-14893251 CTCATTTTAAAGATGGAGGAAGG + Intronic
1039593688 8:38771348-38771370 GCCAAATCACAGCTGGAAGAGGG - Intronic
1039823604 8:41155060-41155082 CTCACATGTCAGCTGGAGGATGG - Intergenic
1040121410 8:43688180-43688202 CTCACATCCCAGATGGTGGGCGG + Intergenic
1040946273 8:52888023-52888045 CTCATATGGCAGAGGGAGGAAGG - Intergenic
1041077149 8:54179020-54179042 TTTAAATCACAGATGTAAGATGG - Intergenic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1041988724 8:63958702-63958724 CTAAAATGACAGAGTGAGGATGG + Intergenic
1042514470 8:69644976-69644998 CTCAAACAAGAGATGGAGCAGGG + Intronic
1042613137 8:70619576-70619598 CAGCAATCACAGATAGAGGAAGG + Intronic
1044230823 8:89775805-89775827 CTCAAAGGAAACATGGAGGATGG + Intronic
1045976083 8:108131774-108131796 TTCAAGTCTCAGATAGAGGAGGG - Intergenic
1046074182 8:109297530-109297552 CTCACATGACAGAAGGCGGAGGG - Intronic
1047167382 8:122454240-122454262 CTCAAATCACAGCTGAGAGATGG + Intergenic
1047533736 8:125700261-125700283 TTCCAAACACAGATGGAGGAAGG + Intergenic
1048081005 8:131127005-131127027 CACAAATAGCAGATGTAGGATGG + Intergenic
1049399145 8:142417095-142417117 CTCAAAGCAAAAATAGAGGACGG - Intergenic
1050417636 9:5433378-5433400 CTCACATCCCAGACGGTGGACGG - Intronic
1050735525 9:8758123-8758145 TTAAAATCAGAGATGCAGGAAGG + Intronic
1050810364 9:9738559-9738581 CTGTAATCACAGAAGGAGGCTGG - Intronic
1055323088 9:75100993-75101015 CTCAAATTAGGGATGGAGGAAGG - Intronic
1056201747 9:84283723-84283745 CTCTTATCTCAGATGGAGGTTGG + Intronic
1056329257 9:85508470-85508492 CTGAAATAACAGATGGAACAGGG + Intergenic
1056334644 9:85555153-85555175 CTCAAATCACAAATTTAGGAGGG + Intronic
1057753937 9:97815291-97815313 CTAAAATCACAAATGAAAGAAGG - Intergenic
1057989507 9:99753445-99753467 TTATAATCACAGATGTAGGATGG - Intergenic
1059254955 9:112921446-112921468 TTCAAAGCATAAATGGAGGATGG + Intergenic
1059427386 9:114229658-114229680 CTCAGATCAGTCATGGAGGATGG + Intronic
1061283468 9:129610088-129610110 CGCAGACCACAGATGGAGGACGG - Intronic
1062353304 9:136149582-136149604 TTTAAATCAAAGATGGAGGAGGG + Intergenic
1186493357 X:9992537-9992559 CTGAAATCACGGATGGAAGCCGG - Intergenic
1186822281 X:13302813-13302835 ATCAAAACACAGATCCAGGAAGG - Intergenic
1189346865 X:40248388-40248410 TGCAAATGAAAGATGGAGGAGGG - Intergenic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1193177949 X:78417004-78417026 CTAAAATCACAAATGAAAGAGGG + Intergenic
1193338074 X:80313721-80313743 CACAAATCAGACATGGAGAAGGG - Intergenic
1193508671 X:82372862-82372884 CTGCAATCACAGGTGGAGGGAGG + Intergenic
1195163963 X:102198912-102198934 CTCTAACCTCACATGGAGGAAGG - Intergenic
1195194898 X:102488183-102488205 CTCTAACCTCACATGGAGGAAGG + Intergenic
1195631768 X:107063691-107063713 CTAAAATCAGAAATGAAGGAGGG - Intergenic
1196538182 X:116872470-116872492 CTCACATGACAGAAGGTGGATGG + Intergenic
1199886627 X:152027326-152027348 CTCAGAACAGAGATAGAGGAGGG + Intergenic
1200957968 Y:8970565-8970587 CACAAATGGCAGAGGGAGGAGGG - Intergenic
1200959252 Y:8982107-8982129 TTTAAATCAGAGATGGAGAAGGG - Intergenic
1201143374 Y:11046968-11046990 CTCCCATCACATATGGAGGGAGG - Intergenic
1201312108 Y:12606480-12606502 TTTAAATCAGAGATGGAGAAGGG + Intergenic
1202089923 Y:21178780-21178802 CTTAAATCAGAGAGGGAGAAGGG + Intergenic