ID: 1010107084

View in Genome Browser
Species Human (GRCh38)
Location 6:72182668-72182690
Sequence GGCGGGCGCGGCGCTGCCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 849
Summary {0: 1, 1: 0, 2: 7, 3: 84, 4: 757}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010107075_1010107084 7 Left 1010107075 6:72182638-72182660 CCACAGCGACGTGGCGCTCCCGC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1010107084 6:72182668-72182690 GGCGGGCGCGGCGCTGCCGGAGG 0: 1
1: 0
2: 7
3: 84
4: 757
1010107073_1010107084 23 Left 1010107073 6:72182622-72182644 CCAGGCACGAGCGGCGCCACAGC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1010107084 6:72182668-72182690 GGCGGGCGCGGCGCTGCCGGAGG 0: 1
1: 0
2: 7
3: 84
4: 757
1010107071_1010107084 29 Left 1010107071 6:72182616-72182638 CCCGCGCCAGGCACGAGCGGCGC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1010107084 6:72182668-72182690 GGCGGGCGCGGCGCTGCCGGAGG 0: 1
1: 0
2: 7
3: 84
4: 757
1010107072_1010107084 28 Left 1010107072 6:72182617-72182639 CCGCGCCAGGCACGAGCGGCGCC 0: 1
1: 0
2: 1
3: 6
4: 106
Right 1010107084 6:72182668-72182690 GGCGGGCGCGGCGCTGCCGGAGG 0: 1
1: 0
2: 7
3: 84
4: 757

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010107084 Original CRISPR GGCGGGCGCGGCGCTGCCGG AGG Exonic