ID: 1010107084 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:72182668-72182690 |
Sequence | GGCGGGCGCGGCGCTGCCGG AGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 849 | |||
Summary | {0: 1, 1: 0, 2: 7, 3: 84, 4: 757} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1010107075_1010107084 | 7 | Left | 1010107075 | 6:72182638-72182660 | CCACAGCGACGTGGCGCTCCCGC | 0: 1 1: 0 2: 0 3: 3 4: 55 |
||
Right | 1010107084 | 6:72182668-72182690 | GGCGGGCGCGGCGCTGCCGGAGG | 0: 1 1: 0 2: 7 3: 84 4: 757 |
||||
1010107073_1010107084 | 23 | Left | 1010107073 | 6:72182622-72182644 | CCAGGCACGAGCGGCGCCACAGC | 0: 1 1: 0 2: 0 3: 3 4: 64 |
||
Right | 1010107084 | 6:72182668-72182690 | GGCGGGCGCGGCGCTGCCGGAGG | 0: 1 1: 0 2: 7 3: 84 4: 757 |
||||
1010107071_1010107084 | 29 | Left | 1010107071 | 6:72182616-72182638 | CCCGCGCCAGGCACGAGCGGCGC | 0: 1 1: 0 2: 0 3: 11 4: 110 |
||
Right | 1010107084 | 6:72182668-72182690 | GGCGGGCGCGGCGCTGCCGGAGG | 0: 1 1: 0 2: 7 3: 84 4: 757 |
||||
1010107072_1010107084 | 28 | Left | 1010107072 | 6:72182617-72182639 | CCGCGCCAGGCACGAGCGGCGCC | 0: 1 1: 0 2: 1 3: 6 4: 106 |
||
Right | 1010107084 | 6:72182668-72182690 | GGCGGGCGCGGCGCTGCCGGAGG | 0: 1 1: 0 2: 7 3: 84 4: 757 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1010107084 | Original CRISPR | GGCGGGCGCGGCGCTGCCGG AGG | Exonic | ||