ID: 1010108417

View in Genome Browser
Species Human (GRCh38)
Location 6:72195203-72195225
Sequence ATGGAGAAGATAAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1819
Summary {0: 1, 1: 1, 2: 12, 3: 176, 4: 1629}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010108417 Original CRISPR ATGGAGAAGATAAAGAAGGA AGG (reversed) Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900466433 1:2827788-2827810 GGGGAGAAGAGAAGGAAGGAAGG + Intergenic
900569571 1:3351672-3351694 AGGGAGGAGAGAAAGAGGGAGGG - Intronic
900808409 1:4782753-4782775 TTGGAGAACAGAAAGAAGAAAGG + Exonic
901336828 1:8456669-8456691 ATGGAGAAGATGAAGTCGGAAGG - Intronic
901419761 1:9143031-9143053 AGGGAGAAGGGAAGGAAGGATGG - Intergenic
902005038 1:13225538-13225560 ATGGAGAAGAGACAGAAGGAGGG - Intergenic
902024264 1:13371332-13371354 ATGGAGAAGAGACAGAAGGAGGG - Intronic
902353240 1:15874540-15874562 ATTAAGAAGATACAGAAGGCAGG - Intronic
902458651 1:16554476-16554498 AGGGAGGAGAGAAGGAAGGAAGG + Intergenic
902493506 1:16853440-16853462 AGGGAGGAGAGAAGGAAGGAAGG - Intronic
902743824 1:18459673-18459695 CTGGAGAAGAGAAAGAAAGAGGG - Intergenic
902819379 1:18934437-18934459 ATTAAAAAGATACAGAAGGAGGG - Intronic
902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG + Intronic
903149766 1:21398422-21398444 AGGCAGAAGAGAGAGAAGGAGGG - Intergenic
903189612 1:21649360-21649382 ATAGAGAAGAAAAAAAAGGAAGG + Intronic
903527432 1:24002513-24002535 ATGAAGAAGATAAAAGAGGCCGG + Intergenic
903571143 1:24306380-24306402 ATGGGGAAGAGAAAGAAGGATGG + Intergenic
903690436 1:25169453-25169475 AAGGAGGAGAAAAGGAAGGAAGG + Intergenic
903965302 1:27085067-27085089 AAGGAGAAGAAAGAGAAGAAGGG - Intergenic
904044117 1:27600133-27600155 ATGGTGAAGAGAGAGAAAGATGG - Intronic
904073081 1:27816944-27816966 AGAGAGAGGAGAAAGAAGGAAGG + Intronic
904232708 1:29089887-29089909 TTTGAGATGAGAAAGAAGGAAGG + Intronic
904273474 1:29365359-29365381 AAGAAAAAGAAAAAGAAGGAAGG - Intergenic
904448337 1:30594179-30594201 AGGAAGAAAAGAAAGAAGGAAGG + Intergenic
904691458 1:32296254-32296276 TTGCAGAAGCTAAAGAAGGGAGG + Intronic
904747930 1:32722491-32722513 AAGGAGAAAAGAAGGAAGGAAGG + Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905529088 1:38662177-38662199 ATGAAGGAGAAAAAGAAGGAAGG + Intergenic
906125632 1:43425460-43425482 GTCGAGAAGCTAAAGGAGGAAGG - Exonic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906275222 1:44510276-44510298 AGGGAGAAAAGAAGGAAGGAAGG + Intronic
906324548 1:44836710-44836732 ATGGAAAAGAAAAAGAAAAAAGG + Intronic
906445217 1:45890520-45890542 AAGGAAAAAATAAGGAAGGAGGG - Intronic
906647592 1:47486872-47486894 AAGGAAAAGAAAAAGCAGGAAGG - Intergenic
906794804 1:48688352-48688374 ATGGAGATGAGGAAGCAGGAAGG - Intronic
907072894 1:51553208-51553230 ATGGCTACGAGAAAGAAGGAAGG - Intergenic
907353440 1:53852556-53852578 ACGGAGAAGAGAAAGAGAGAAGG - Intronic
907445653 1:54506217-54506239 ATGAAGAAGGGAAAGAAAGAGGG - Intergenic
907468326 1:54654227-54654249 AGGGAGAGGAGAAGGAAGGAAGG + Intronic
907492826 1:54819777-54819799 AAAGAGAAGAAAAGGAAGGAAGG - Intronic
907640181 1:56181177-56181199 ATGGAGAAGATACAGTAGAAAGG + Intergenic
907688184 1:56634847-56634869 ATGGAGAATATCAAGGATGAAGG + Intronic
907736798 1:57121199-57121221 AAGGAGAAGAAGGAGAAGGAGGG + Intronic
907797984 1:57736778-57736800 TTAGAGAAAAGAAAGAAGGAAGG - Intronic
907885926 1:58592329-58592351 ATGGAGCAGAAATAGAGGGAGGG - Intergenic
907886048 1:58593271-58593293 ATGGGGAAGGGAAAGAAGAAAGG - Intergenic
907886054 1:58593295-58593317 ATGGGGAAGGGAAAGAAGGGAGG - Intergenic
908263634 1:62358184-62358206 AAGGGGGAGGTAAAGAAGGAAGG - Intergenic
908397870 1:63742817-63742839 AAGGAGAAGATGAAGCAGGGAGG + Intergenic
908503457 1:64769736-64769758 ATGCTGAAGGTAAGGAAGGAAGG - Intronic
908946701 1:69507101-69507123 AAAGAGAAGACAGAGAAGGAAGG - Intergenic
909100715 1:71344425-71344447 ATGAAGAAGATATAGAAGGAAGG - Intergenic
909275213 1:73675050-73675072 ATGAAGAAAAGAAAGAAGGAAGG + Intergenic
909281293 1:73756971-73756993 TTTGAAAAGAGAAAGAAGGATGG - Intergenic
909296402 1:73954436-73954458 ATAGAGAAGGGAAGGAAGGAAGG - Intergenic
909487835 1:76193415-76193437 TAAGAGAAGATAAAGAAGGGAGG - Intronic
909498257 1:76304151-76304173 ATGAAGGAGAGAAAGAAGGAAGG - Intronic
909583828 1:77266903-77266925 ATGAAGAAGGCAGAGAAGGATGG + Intergenic
909735216 1:78950618-78950640 TTGGAGAAGATAAAGAAAAGAGG + Intronic
909744534 1:79077010-79077032 AAGGAAAAGAGAAAGAAGGTAGG + Intergenic
909786364 1:79618927-79618949 AGGGAGAAAAGAGAGAAGGATGG - Intergenic
909896723 1:81080448-81080470 ATAGAGTAGATAAACAAGAATGG - Intergenic
909898353 1:81102556-81102578 ATCCAGAAGATAAATAATGAAGG + Intergenic
909969619 1:81966028-81966050 AGGGAAAAGATAAAGGAGGTGGG - Intronic
910015327 1:82516919-82516941 AAGTAGAACATAAAGAAGGAAGG + Intergenic
910164811 1:84315056-84315078 AAAGAGAAGAAAAAGAAAGAAGG - Intronic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
910817328 1:91305111-91305133 CTTGAAAAGAAAAAGAAGGAAGG - Intronic
910990763 1:93053554-93053576 ATTGAGAAGGTGAAAAAGGAAGG - Intergenic
911201025 1:95043822-95043844 AGGAAGAAGAGAGAGAAGGAGGG + Intronic
911244415 1:95501030-95501052 ATGGAGAGGGTAAAGGAGAAAGG - Intergenic
911431658 1:97796646-97796668 AAGGGAAAGACAAAGAAGGAGGG + Intronic
911444908 1:97979780-97979802 ATGGATAAGATTTAGAAAGATGG + Intergenic
911519328 1:98909302-98909324 ATAAAGAACAGAAAGAAGGAAGG - Intronic
911763738 1:101647581-101647603 AGGGAGAAAAGAAAAAAGGAAGG - Intergenic
911866888 1:103038540-103038562 ATGGTGATGATAAAGAGTGAGGG + Intronic
912088495 1:106040284-106040306 AAAGAAAAGAAAAAGAAGGAAGG + Intergenic
912176766 1:107168183-107168205 AAGAAAAAGAGAAAGAAGGAAGG - Intronic
912740117 1:112186602-112186624 AAGGAGAATACAAAGAAGGGAGG - Intergenic
912901908 1:113660258-113660280 ATGGAGAAGGGAAAGAACAAAGG - Intronic
913072102 1:115308716-115308738 ATGAAGGAGGTAAAGAAGAAAGG + Intronic
913238588 1:116807188-116807210 ATGGAGAAGAATAAGAATAAAGG - Intergenic
913260791 1:116996271-116996293 ATGGAGGAGGCAAAGAAGCATGG - Intergenic
913368278 1:118067451-118067473 ATGGAGAAGGGAAAGAGGGAGGG - Intronic
913524904 1:119681660-119681682 GTGGAGCAGATAAAGCTGGAAGG + Intronic
913692552 1:121293120-121293142 ATGGAGAAGTTGTAGAAAGAAGG + Intronic
913721597 1:121602013-121602035 ATGGAAAACAAAAAGAAGCAGGG - Intergenic
913963525 1:143356630-143356652 ATGGAGGAGAAAAAGAAGTGAGG - Intergenic
914057883 1:144182219-144182241 ATGGAGGAGAAAAAGAAGTGAGG - Intergenic
914121263 1:144784146-144784168 ATGGAGGAGAAAAAGAAGTGAGG + Intergenic
914145004 1:144986974-144986996 ATGGAGAAGTTGTAGAAAGAAGG - Intronic
914247904 1:145899421-145899443 ATGGTCAAAACAAAGAAGGAGGG + Intronic
914709905 1:150203610-150203632 ATAGAGATGATAAATAAGGTTGG - Intergenic
914877107 1:151520301-151520323 AGCTAGAAGAAAAAGAAGGAGGG - Intronic
914964655 1:152244181-152244203 ATGGAGAAGAAGGAGAAGGGAGG - Intergenic
915897478 1:159823268-159823290 ATGGAGAAGGGAAAGAAAGGTGG - Intergenic
916323341 1:163530419-163530441 ATGGAGAAGAAGGGGAAGGAAGG - Intergenic
916339279 1:163710828-163710850 AGGAAGAAGAAAAGGAAGGAAGG - Intergenic
916473083 1:165142739-165142761 ATGAAGGAGAGAAAGGAGGAAGG - Intergenic
916616266 1:166444252-166444274 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
916779532 1:168009506-168009528 ATGGAGGAAAGAAGGAAGGAAGG - Intronic
916881604 1:169024426-169024448 AAGGAGAAGAGGAGGAAGGAAGG + Intergenic
917146722 1:171900172-171900194 TTGCAGAAAATAAACAAGGAGGG + Intronic
917154789 1:171984623-171984645 ATGGAGAAAATAAAATAGCAGGG - Intronic
917157398 1:172019095-172019117 AGAGAGAAAGTAAAGAAGGAAGG - Intronic
917231682 1:172844715-172844737 ATGGAGGAAAGAAAGAAGGAAGG + Intergenic
917289638 1:173459924-173459946 ATGGAGAAGAGAGAAAAGCAAGG + Intergenic
917593237 1:176498954-176498976 AGGGAGAGAAAAAAGAAGGAGGG - Intronic
917885310 1:179378443-179378465 GTGGAGAAGAGAAAGAATGTGGG + Intronic
918204333 1:182295858-182295880 AGGAGGAAGAGAAAGAAGGAAGG - Intergenic
918523411 1:185439538-185439560 AAGGAGAGGATAGAGAAGGTGGG + Intergenic
918805940 1:189044718-189044740 ATGCAGAAGATAAAAAAGCAAGG - Intergenic
918876129 1:190046259-190046281 AAGGAGAAAAGGAAGAAGGAAGG + Intergenic
918970438 1:191408998-191409020 GTGTAGAAGCTAAAGAAGAATGG + Intergenic
919015533 1:192028878-192028900 ATGGAAAACAGAAAGAAGCAGGG - Intergenic
919016832 1:192049241-192049263 ATGAAGAAGATAACTCAGGATGG + Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919244928 1:194970359-194970381 ATGAATAACATCAAGAAGGAAGG - Intergenic
919347969 1:196410917-196410939 AAGGAGAAAAGAAAGAAAGAAGG - Intronic
919383431 1:196887461-196887483 ATGGAGAAGAAAATGAAGATAGG - Intronic
919580330 1:199364490-199364512 ATGGAAAAGAAAAAAAAGGCAGG - Intergenic
919592359 1:199520615-199520637 ATAAAGTAGATCAAGAAGGAAGG - Intergenic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920479871 1:206311477-206311499 ATGGAGAAGTTGTAGAAAGAAGG + Intronic
920517438 1:206596608-206596630 ATGCAGAAGCAAAAGAAGGCTGG - Intronic
920521254 1:206628700-206628722 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
920776864 1:208947251-208947273 ATAGTAAAGAAAAAGAAGGAAGG + Intergenic
920905846 1:210166640-210166662 AAGGAGAAGGGAAAGAAGGGAGG + Intronic
920922226 1:210307524-210307546 ATGGAGTAGAAACAGAAGGGAGG - Intergenic
921110083 1:212027407-212027429 AGAGATAAGATTAAGAAGGAGGG + Intronic
921170991 1:212549561-212549583 AAGCAGAAAATAAAGTAGGAAGG + Intergenic
921342165 1:214145026-214145048 ATGGAGATGATGGAGATGGATGG + Intergenic
921359782 1:214320037-214320059 AGGCAGAAAAGAAAGAAGGAAGG + Intronic
921397055 1:214679620-214679642 AAGGAGAAGAAGAAGAAGAATGG - Intergenic
921448492 1:215274693-215274715 AGGGAGAAAAGAAGGAAGGAAGG - Intergenic
921615600 1:217263180-217263202 ATTGACTAGATAAAGAAGGAGGG - Intergenic
921812266 1:219528658-219528680 ATTTAGAAGTCAAAGAAGGATGG + Intergenic
921872174 1:220152850-220152872 ATGAAGAAAATAAAGAGGGCCGG - Intronic
921979133 1:221236016-221236038 AAGGAGGAGAGAAAGAAGGGAGG + Intergenic
922004899 1:221520413-221520435 AGGAAGAAAAGAAAGAAGGAAGG - Intergenic
922120031 1:222656591-222656613 ATGCAAAAGAAAAAGCAGGAGGG - Intronic
922287465 1:224182976-224182998 CCGGAGAAGATGAAAAAGGAAGG - Intronic
922382308 1:225043123-225043145 ATTGAGACTATAAAGAATGAGGG + Intronic
922820774 1:228483985-228484007 AGGAAGGAGAAAAAGAAGGAAGG - Intergenic
922820781 1:228484031-228484053 AGGGAAAAGAAAAAGAAGAAAGG - Intergenic
922890908 1:229061505-229061527 AGAAAGAAGATAGAGAAGGAAGG + Intergenic
922907627 1:229186543-229186565 ATGGAGATAATAAAGCAGGGAGG - Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
923455829 1:234164409-234164431 AGGGAGAGGAAAAAGAAAGAGGG - Intronic
923673555 1:236062255-236062277 ATGGTGGGGAAAAAGAAGGAGGG - Intronic
923884854 1:238143096-238143118 ATTGTGAGGATAAGGAAGGAAGG + Intergenic
924481172 1:244435637-244435659 ATGGAGGAGGAAGAGAAGGATGG - Intronic
1063092169 10:2875026-2875048 GAGCAGAAGATAGAGAAGGACGG - Intergenic
1063225639 10:4013027-4013049 AGGGAGAAAGAAAAGAAGGAAGG - Intergenic
1063286166 10:4691345-4691367 TTTTAGAAGATAAAGAAAGATGG + Intergenic
1063330683 10:5155932-5155954 ATGGAGAAGAGGCAGAATGAAGG - Intergenic
1063525257 10:6778875-6778897 AGGGAGAGAATGAAGAAGGAAGG + Intergenic
1063624028 10:7672305-7672327 GGGAGGAAGATAAAGAAGGAAGG + Intergenic
1063678623 10:8164487-8164509 ACCGAGAAGATACAAAAGGAAGG - Intergenic
1063743743 10:8855835-8855857 ATTGTCAAGATACAGAAGGAGGG - Intergenic
1063866946 10:10374912-10374934 ATGGAGATGGAAAAGCAGGAAGG + Intergenic
1063905143 10:10773949-10773971 ATGGGGAAGATAATGATGGGAGG - Intergenic
1063919701 10:10920693-10920715 ATGGAGAAAAGAAGGAAGGAAGG + Intergenic
1064039603 10:11948426-11948448 ATGAAGAAGAAGAAGAAGGTGGG - Exonic
1064121563 10:12623483-12623505 AGGGAGAAAGGAAAGAAGGAAGG - Intronic
1064149990 10:12854697-12854719 ATTGAGAAGGTAGAGATGGAGGG + Intergenic
1064352465 10:14588813-14588835 AGGAAGAAGAGAGAGAAGGAGGG + Intronic
1064516235 10:16151946-16151968 AAAGAGAAAAGAAAGAAGGAAGG + Intergenic
1064550300 10:16493728-16493750 AGGGAGAAGAGAAAGAAAGAAGG + Intronic
1064686513 10:17867315-17867337 AGGAAGAAGAAGAAGAAGGAAGG - Intronic
1064756120 10:18573040-18573062 ATGGAGAAGAGAATGGAGAATGG - Intronic
1064959731 10:20950459-20950481 AGGGAGAAGAGGCAGAAGGAAGG - Intronic
1065092127 10:22245608-22245630 ATGAAGTAGATAAACCAGGAAGG + Intergenic
1065123651 10:22552252-22552274 AGGTAGAAAATAAAGCAGGATGG + Intronic
1065228042 10:23567210-23567232 AGGGAGATGATAAAAATGGAAGG - Intergenic
1065260626 10:23919879-23919901 CTGGAGAAGGTCAGGAAGGAAGG - Intronic
1065744137 10:28823336-28823358 ATGGAGAAGAGAAAAATAGAAGG - Intergenic
1065776682 10:29126913-29126935 CTGGAGAAGAGAAAGAGAGAGGG - Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066553412 10:36584521-36584543 AGAAAGAAGAAAAAGAAGGAAGG - Intergenic
1066559010 10:36647791-36647813 AGGGAGGAGAGAAAGAATGAGGG + Intergenic
1066617053 10:37305829-37305851 AGGAAGAAAAGAAAGAAGGAAGG + Intronic
1067150648 10:43729897-43729919 AAGAAGAAGATGAAGAAGAAGGG + Intergenic
1067161463 10:43828396-43828418 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1067168895 10:43888468-43888490 AAGGAAAAGAGAAAGAAGGAAGG - Intergenic
1067196423 10:44123389-44123411 ATGAAGAAGATAAGGAAAGAAGG + Intergenic
1067398847 10:45951810-45951832 ATGGGGTGGAGAAAGAAGGACGG + Intergenic
1067544113 10:47179579-47179601 GTGGTGAAGATTAAGAAAGAAGG + Intergenic
1067867168 10:49921046-49921068 ATGGGGTGGAGAAAGAAGGACGG + Intronic
1067914655 10:50384406-50384428 AGGGAAAGGAGAAAGAAGGAAGG - Intronic
1068261864 10:54593990-54594012 AGAGAGAAGATACAGAAGGTGGG + Intronic
1068690371 10:59907361-59907383 ATGAAGAAAAAAAAAAAGGAAGG + Intergenic
1068691725 10:59922868-59922890 AAGGAGAAGAGATAGAAAGAGGG + Intergenic
1068775265 10:60862083-60862105 AGGAAGAAGGGAAAGAAGGAAGG - Intergenic
1069468614 10:68665066-68665088 ATTGAAAAGATAAAAAAGGCTGG - Intronic
1069987488 10:72294299-72294321 AGGGAGAAGAGGAAGAATGAAGG + Intergenic
1070092032 10:73296391-73296413 GTAGAGAAGAAAAACAAGGAAGG + Intronic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071185523 10:83039687-83039709 AGAGAGAAGAAAAAGAGGGAAGG - Intergenic
1071270643 10:84003817-84003839 ATGGGGAAGGTGAGGAAGGAGGG - Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071368195 10:84923045-84923067 AAGGAGAAGCTAGAAAAGGATGG + Intergenic
1071426331 10:85557723-85557745 AGGAAGAAAAGAAAGAAGGAAGG + Intergenic
1071426990 10:85567969-85567991 ATTGAAAAAATAAAGAAGGAAGG + Intergenic
1071444835 10:85736040-85736062 AGGGAGAAAGGAAAGAAGGAAGG + Intronic
1071807737 10:89142760-89142782 AAGGAGAAGAGAAAGGAGAAGGG + Intergenic
1071930338 10:90462628-90462650 ATGAAGCAGAGAAAGAGGGATGG + Intergenic
1072072449 10:91932189-91932211 AAGGAAAAGTTTAAGAAGGATGG + Intronic
1072095108 10:92170648-92170670 ATGGAGAATGAAAGGAAGGAAGG + Intronic
1072124242 10:92431349-92431371 AAAGAGAAAAGAAAGAAGGAAGG - Intergenic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072309599 10:94141627-94141649 AAGGAGGAAAGAAAGAAGGAAGG + Intronic
1072309608 10:94141667-94141689 AGGGAGGAAAGAAAGAAGGAAGG + Intronic
1072586863 10:96790391-96790413 AAAGAGAAAAGAAAGAAGGAAGG - Intergenic
1072649370 10:97282577-97282599 AAGGGGAAGATACAGAAGGGAGG - Intronic
1072765760 10:98093961-98093983 CTGGAGATAATAAAGAAAGAAGG + Intergenic
1072767544 10:98107903-98107925 AGGGAGAGGATCTAGAAGGAAGG + Intergenic
1072875891 10:99172884-99172906 AAGAAGAAGAAAAAGAAGAAAGG + Intronic
1072916013 10:99537622-99537644 AGGAGGAAGAAAAAGAAGGAGGG + Intergenic
1073021568 10:100448996-100449018 GAGGAGGAGAGAAAGAAGGAGGG + Intergenic
1073061649 10:100737086-100737108 ATGGGAAAGGGAAAGAAGGAGGG - Intronic
1073447163 10:103588606-103588628 AGGGAGGAGAGAAGGAAGGAGGG + Intronic
1073638300 10:105221897-105221919 TTAAAGAAGAGAAAGAAGGAGGG + Intronic
1073643299 10:105274608-105274630 AAGGGGAAGAGAAAGAAGCATGG - Intergenic
1073731358 10:106292016-106292038 AAGGAGAAGAGAGGGAAGGAAGG + Intergenic
1073857798 10:107697494-107697516 AGGAGGAAGAAAAAGAAGGAAGG - Intergenic
1074326467 10:112455555-112455577 AGGGAGCAGAGAAGGAAGGAAGG - Intronic
1074371310 10:112902902-112902924 AGGAAGAAAAGAAAGAAGGAAGG - Intergenic
1074673102 10:115818053-115818075 ATGGAGCAGCTAAAAGAGGAGGG - Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1074758800 10:116648495-116648517 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
1074874126 10:117601155-117601177 AAAGAAAAAATAAAGAAGGAGGG - Intergenic
1074918852 10:117986403-117986425 AAGGAAAATAGAAAGAAGGAAGG + Intergenic
1074981086 10:118620392-118620414 AAGGAGCAGATTCAGAAGGAAGG - Intergenic
1075065674 10:119287410-119287432 AGGGAGAAGGTAAGGAGGGAGGG + Intronic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075295164 10:121268752-121268774 ATGGATGAGATAAAGCTGGAAGG + Intergenic
1075537141 10:123280942-123280964 ATGGAGGAAAAAAAGAAAGAAGG - Intergenic
1075591503 10:123694687-123694709 AAGGAAAAGAAAAAGAAGGAAGG + Intergenic
1076039497 10:127232040-127232062 ATGGAGAAGGCAGAAAAGGAGGG + Intronic
1076448879 10:130541472-130541494 AAGGAGAAGAAAAAGAGGGGAGG - Intergenic
1076727481 10:132420338-132420360 AGGAAGAAGAGAAAGAAGGCTGG - Intergenic
1077272310 11:1687004-1687026 AGGGAGGAGGCAAAGAAGGAGGG - Intergenic
1077600792 11:3573114-3573136 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1077787624 11:5401836-5401858 AAGCAGAAGAAAAAGAGGGAAGG - Intronic
1077811877 11:5646432-5646454 ATGGAAGAGATAAGGGAGGATGG - Intergenic
1078001829 11:7502958-7502980 TTGGAGAATAGAAAGAAAGAAGG + Intronic
1078362545 11:10680447-10680469 AAGGGAAAGAGAAAGAAGGAAGG + Intronic
1078380865 11:10839271-10839293 ATGGAATAGATAATGAAGGAAGG + Intronic
1078658484 11:13264399-13264421 ATGGAGAAGAGAAAACAGTAGGG + Intergenic
1078958695 11:16236106-16236128 ATGGAATAAAGAAAGAAGGAAGG - Intronic
1079252041 11:18793517-18793539 ATGGAGAAAATGAGGAGGGAGGG - Intergenic
1079675004 11:23215981-23216003 AGGGACAAGATAAAGGAGAAAGG + Intergenic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1079817176 11:25076470-25076492 ATGTATATGATAAAGAAGAAAGG + Intronic
1079852547 11:25555143-25555165 TTGGAGAAGAGAAAGAAGATGGG - Intergenic
1080053247 11:27878590-27878612 AGGGAGAAAAGAAAGAAGGAAGG - Intergenic
1080076112 11:28151782-28151804 ATTTACAAGATACAGAAGGAGGG - Intronic
1080209477 11:29769487-29769509 ATGGAAAACAAAAAGAAGGCAGG - Intergenic
1080556623 11:33422784-33422806 ATGAAAAAGAAAAAAAAGGAAGG + Intergenic
1080708255 11:34720019-34720041 ATGGAGAAGAGCAAGAGGGAAGG + Intergenic
1080895766 11:36447833-36447855 ATGGAAGAGATGGAGAAGGAGGG + Intronic
1080904289 11:36524999-36525021 AGGAAGAAAAGAAAGAAGGAAGG - Intronic
1081006638 11:37752692-37752714 AAGGGAAAGAGAAAGAAGGAAGG - Intergenic
1081078961 11:38714998-38715020 ATGGGGAATAGAAGGAAGGAAGG - Intergenic
1081232608 11:40604769-40604791 ATGGATAAAATAAAGGAAGAAGG + Intronic
1081575210 11:44314879-44314901 AAGGAAAAGAGAGAGAAGGAAGG - Intergenic
1081762711 11:45587785-45587807 AGGAAGAAGAGACAGAAGGAAGG + Intergenic
1082211859 11:49513761-49513783 ATGAAAAAGAGAAAAAAGGAGGG + Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1082805645 11:57448049-57448071 AGAAAGAAGAAAAAGAAGGAAGG + Intergenic
1082849876 11:57754931-57754953 AAGAAGAAAAAAAAGAAGGAAGG - Intronic
1083738690 11:64696086-64696108 GTGGAGGAGAGAAAAAAGGAGGG - Intronic
1084256712 11:67947699-67947721 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1084299090 11:68234207-68234229 AAAGAGAAGAGAAAGAAGCAGGG - Intergenic
1084441856 11:69179127-69179149 GGGGAGAAGAGAAGGAAGGAGGG + Intergenic
1084470450 11:69356305-69356327 AGGGAGGAGAGAAGGAAGGAAGG + Intronic
1084534428 11:69748305-69748327 ATGGAGAAGAAAGAAAGGGAGGG - Intergenic
1084816078 11:71647675-71647697 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1085021348 11:73211443-73211465 AGGAAGAAAAGAAAGAAGGAAGG + Intergenic
1085249383 11:75132217-75132239 AAGGAAAGGAGAAAGAAGGAAGG + Intronic
1085702843 11:78760434-78760456 ATAGGGGAGAAAAAGAAGGATGG + Intronic
1085794247 11:79522750-79522772 ATGGAGAAGACAGGGAAGAAAGG + Intergenic
1085857514 11:80192248-80192270 AATGAAAAGAGAAAGAAGGAGGG + Intergenic
1085863501 11:80261100-80261122 AAGGAGAGGAAAAAGAAGGCAGG - Intergenic
1086297878 11:85391395-85391417 TTCCAAAAGATAAAGAAGGAGGG + Intronic
1086501723 11:87460584-87460606 ATGGAAAAGCTAAGGAAGGTAGG + Intergenic
1086517427 11:87628913-87628935 ATATAGAAGATACAGAAGAAGGG - Intergenic
1086637779 11:89111069-89111091 ATGAAAAAGAGAAAAAAGGAGGG - Intergenic
1086818427 11:91403152-91403174 ATGGAGCAAATAATGAATGATGG - Intergenic
1087481409 11:98705725-98705747 ATGGAAAAAATAAAGATGAAAGG + Intergenic
1087514729 11:99143546-99143568 ACGGAGAAAGGAAAGAAGGAAGG - Intronic
1087527002 11:99328234-99328256 ATTGACAAAATAATGAAGGAAGG + Intronic
1087806523 11:102561381-102561403 ACAGAGAAGGAAAAGAAGGAAGG - Intergenic
1087993005 11:104769257-104769279 AGGCAGAAGTTAAAGTAGGAAGG + Intergenic
1088007405 11:104959681-104959703 ATGGAAAAGAGAATGAAGGATGG - Intronic
1088010651 11:104996788-104996810 GTGGAGAAAATAAAGTAGGAAGG + Intronic
1088011896 11:105013790-105013812 ATGGAGGAGCAAATGAAGGATGG - Intronic
1088054692 11:105560568-105560590 GAGGAGAAAATAAAGTAGGAGGG + Intergenic
1088402372 11:109435372-109435394 AGGGAGATGCTAAAGAAGGCAGG + Intergenic
1088719191 11:112576791-112576813 ATAGAGAAGAAAAGGAAGCATGG + Intergenic
1088989792 11:114942789-114942811 AGGAAGATGATAAAAAAGGAGGG + Intergenic
1089035774 11:115389112-115389134 GGGAAAAAGATAAAGAAGGAAGG + Intronic
1089099363 11:115948664-115948686 TTGATGAAGATAAAGAAAGATGG + Intergenic
1089196284 11:116695685-116695707 ATGGAAAAGACAAGGATGGAAGG - Intergenic
1089267489 11:117275843-117275865 TTCCAGAAGATCAAGAAGGAAGG + Intronic
1089476934 11:118771611-118771633 AGGGAGAAGGCAAAGGAGGAAGG + Intronic
1089659776 11:119978311-119978333 ATGGAGAAGGTGGTGAAGGAGGG + Intergenic
1090190682 11:124764862-124764884 ATGGAGAAGATAGCAAAGGCTGG - Intergenic
1090628506 11:128626381-128626403 AAGGAGAAGAAAAAGAATTAAGG + Intergenic
1091112417 11:132982197-132982219 AAGGAGAGGAGAAAGAAGCAGGG - Intronic
1091470515 12:722212-722234 ATAGAGAAAAGAAAGAAAGAAGG + Intergenic
1091470519 12:722297-722319 ATAGAGAAAAGAAAGAAAGAAGG + Intergenic
1091930147 12:4389416-4389438 AAGGAGAAGAAACAGAGGGAGGG - Intergenic
1092083860 12:5739704-5739726 ATGAAGAAAATAAAAAGGGAGGG + Intronic
1092261031 12:6953443-6953465 AGAGAGAAGAGAGAGAAGGAAGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092361387 12:7839614-7839636 ATGGAGAAGATGCTGAAGGAGGG + Intronic
1092375831 12:7954878-7954900 ATGGAGAAGATGCTGAAGGAGGG + Intergenic
1092426926 12:8382372-8382394 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1092518391 12:9240152-9240174 ATGAAGAAGAGGAAGAAGGTGGG - Intergenic
1092796091 12:12111320-12111342 ATGAAGAAGAGGAAGAAGGTGGG + Intronic
1092901689 12:13065836-13065858 ATGGACAAGATAAAGAAATGTGG - Intronic
1093060276 12:14595098-14595120 GTGGAAAAAAAAAAGAAGGAAGG - Intergenic
1093086394 12:14870034-14870056 ATGGAGAACATAGAAAAGCAGGG - Intronic
1093106016 12:15088035-15088057 AAGGAAAAGAGAAAGCAGGAGGG + Intergenic
1093145985 12:15567433-15567455 AAGGAGAAGAAAAAGAAAGCTGG - Intronic
1093535292 12:20216277-20216299 TTGGAGAAGAGAAAGAAGCGTGG + Intergenic
1093913360 12:24772521-24772543 ATGAAGAAAGGAAAGAAGGAAGG + Intergenic
1094027185 12:25970978-25971000 ATGCATATGATATAGAAGGAAGG - Intronic
1094282111 12:28751832-28751854 ATGGAGAAGAAAAGAAGGGAAGG - Intergenic
1094330082 12:29281694-29281716 ATGAAGAAGTGAAAGAAAGAAGG + Intronic
1094373437 12:29763905-29763927 ATGGAGTAAATAAAGAAGTGAGG + Intronic
1094683368 12:32685845-32685867 ATGGAGAAAAAAAAGAGAGAGGG - Intronic
1095820952 12:46478037-46478059 AAGGAGCACATCAAGAAGGAGGG - Intergenic
1095929111 12:47608012-47608034 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1095999398 12:48116197-48116219 AAGGAGAAAAGAAGGAAGGAGGG - Intronic
1096093222 12:48916836-48916858 ATGGAGAAAAGAGAGAGGGAAGG - Intronic
1096185462 12:49577670-49577692 GTGGAGAATTTAAAGAAGAATGG - Intronic
1096447460 12:51706471-51706493 AGGAAGAAGGTGAAGAAGGAGGG + Exonic
1096451035 12:51741545-51741567 AAGGGGAAGACAAGGAAGGAAGG - Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096720273 12:53516237-53516259 ATGGTTAAACTAAAGAAGGAGGG + Exonic
1096914589 12:55017678-55017700 AAGCAGCAGAGAAAGAAGGAAGG + Intergenic
1097094623 12:56536516-56536538 AGAGAGAAAAGAAAGAAGGAAGG - Intronic
1097268965 12:57762539-57762561 AGGGGCAAGACAAAGAAGGAAGG + Exonic
1097308455 12:58093958-58093980 TTGGGGAAGAGAAGGAAGGAAGG + Intergenic
1097356286 12:58605815-58605837 AAGGAGAAATGAAAGAAGGAAGG - Intronic
1097548060 12:61029545-61029567 AAGAAGAAGAGAAAGAAGAAAGG - Intergenic
1097583209 12:61483382-61483404 ATGGAAAACAGAAAAAAGGAGGG + Intergenic
1097851760 12:64418014-64418036 ATAGAGAAGAAAAAGAATAATGG - Intronic
1098000094 12:65931974-65931996 ATGGAAAAATTAAAGAATGAAGG - Intronic
1098017834 12:66125182-66125204 ATGTAGAAGATAAATGAGAAGGG + Intronic
1098176602 12:67798539-67798561 AGAGAGAAGAAAAAGAAGGCAGG - Intergenic
1098325312 12:69296178-69296200 CTGGAGAAGATATGGGAGGAAGG + Intergenic
1098656994 12:73044625-73044647 ATGGACATGGGAAAGAAGGATGG - Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099356606 12:81645208-81645230 AAGGAGAAGAAAGAGAAAGAAGG + Intronic
1099589300 12:84567117-84567139 ATGGAGAAAATATAGGAGGTTGG - Intergenic
1099868074 12:88309531-88309553 AAGGAGGAGGGAAAGAAGGAAGG - Intergenic
1099934266 12:89106999-89107021 ATGGAAAAGATAAAGAAAAGAGG + Intergenic
1100427442 12:94500415-94500437 AGGGAGGAAAGAAAGAAGGAAGG + Intergenic
1100877254 12:98975240-98975262 ATGAAGGAAAGAAAGAAGGAAGG - Intronic
1100955396 12:99902581-99902603 ATGGAAGAGGGAAAGAAGGAAGG + Intronic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101545447 12:105707833-105707855 ATGGAGCAGATAAACATGGAAGG + Intergenic
1101797437 12:107988454-107988476 AAGGAGGAGGGAAAGAAGGAGGG + Intergenic
1101830954 12:108256102-108256124 AGAGAGAAGAGAAAGAAGGAAGG - Intergenic
1101861882 12:108489146-108489168 AAGGAGAAGGGAAAGAGGGAAGG + Intergenic
1101887938 12:108684647-108684669 AAGGAGAAAATAAATAAGAATGG + Intronic
1102159411 12:110756441-110756463 ATGGAGAAGAGACAGTAGGCAGG - Intergenic
1102167846 12:110820701-110820723 AGGAAGAAGAAGAAGAAGGAGGG - Intergenic
1102332830 12:112049612-112049634 CTGGAGAAATTAAAGACGGACGG + Intronic
1102464400 12:113120108-113120130 TTGGAGAACGTCAAGAAGGAGGG - Intronic
1102513312 12:113430021-113430043 AAGGAGAAAAGAAGGAAGGAAGG - Intronic
1102544155 12:113642638-113642660 ATGGAGGGGAGAAGGAAGGAAGG - Intergenic
1102544196 12:113642762-113642784 AGGAAGAAGGGAAAGAAGGAAGG - Intergenic
1102717413 12:114986314-114986336 AGGGAGTAAAGAAAGAAGGAAGG - Intergenic
1102754138 12:115323192-115323214 ATGGAGGAAGGAAAGAAGGAAGG + Intergenic
1102764785 12:115423182-115423204 AGGGAGAAAGGAAAGAAGGAGGG + Intergenic
1102913680 12:116737583-116737605 AGGAGGAAGATAAGGAAGGAGGG + Intronic
1102960463 12:117089796-117089818 ATGAAGAAGATAAAGAGAAAGGG + Intronic
1103115811 12:118330721-118330743 AGGGAAAAGAAAAAGAAAGAAGG + Intronic
1103366833 12:120389781-120389803 AGGAAGGAGAGAAAGAAGGAAGG + Intergenic
1103366999 12:120390709-120390731 AAGGAGAAGGAAAGGAAGGAAGG + Intergenic
1103662074 12:122528236-122528258 AGTGAGGAGATGAAGAAGGAGGG - Intronic
1104091275 12:125519858-125519880 ATTGAGAAAATAAAGAATAAGGG - Intronic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104232123 12:126895639-126895661 TTGAAGAAAGTAAAGAAGGAAGG - Intergenic
1104282222 12:127388510-127388532 ATTGAGAAAATAAAGAATAACGG + Intergenic
1104565926 12:129883044-129883066 AGGGAAAAGGGAAAGAAGGAGGG + Intronic
1104603219 12:130167675-130167697 AGGGAGGAAAGAAAGAAGGAAGG + Intergenic
1105250154 13:18691664-18691686 AAGGAAAAGAGAAGGAAGGAAGG + Intergenic
1105544856 13:21343963-21343985 AGGGAGGAGATGGAGAAGGAGGG - Intergenic
1105892723 13:24693355-24693377 ATGGAGAGGAAAAGGGAGGAAGG - Intronic
1106012816 13:25841908-25841930 ATGGGGTAGAGAGAGAAGGAAGG + Intronic
1106525750 13:30539856-30539878 GAGGAAAAGAAAAAGAAGGACGG - Intronic
1106868499 13:33993661-33993683 ATGGAGAAGAGAAGCAAGAAAGG + Intergenic
1107147399 13:37073308-37073330 ATGAAGAAGAAAAAGAAAGCAGG + Intergenic
1107150733 13:37107733-37107755 ATGGGAAAGATAAAGCAGGCTGG - Intergenic
1107197478 13:37670250-37670272 ATGGAGAAATTAAACAAGGCTGG + Intronic
1107659185 13:42621750-42621772 AAGCAGAAGAGAAAGGAGGAAGG + Intergenic
1107732092 13:43358567-43358589 CTGATGATGATAAAGAAGGACGG - Intronic
1108020171 13:46120214-46120236 ATGAAAAAGATAAACCAGGAAGG + Intergenic
1108022531 13:46143276-46143298 ATGAAGAAGGTAAACAATGATGG - Exonic
1108090219 13:46841695-46841717 ATGGAAAAGAAAAGGAAGGAGGG - Intronic
1108283353 13:48881448-48881470 CTGGAGAAGAGAAAGGAGAATGG + Intergenic
1108591895 13:51919929-51919951 ATGAAGGAGAAAAGGAAGGAAGG + Intergenic
1108598653 13:51972102-51972124 ATGCTGAAGATAAGGAGGGAAGG - Intronic
1108698983 13:52927598-52927620 AGGGAGAAGAAGGAGAAGGAGGG + Intergenic
1108794814 13:54017974-54017996 AGGGAGAAGAAAAGGAAGGAAGG + Intergenic
1108819784 13:54334562-54334584 GTGGAGAAGGTACAAAAGGAGGG + Intergenic
1109185770 13:59265797-59265819 ATGAAAAAGAAAAAAAAGGAAGG - Intergenic
1109371911 13:61433137-61433159 ATGAAGAAAAAAATGAAGGAAGG - Intergenic
1109689963 13:65873566-65873588 ATGAAGAAGGAAAGGAAGGAAGG + Intergenic
1109977672 13:69861282-69861304 GTGGAGAATTTAAAGAGGGAAGG - Intronic
1110002766 13:70226483-70226505 ATGTAGAATAAAAAGAATGATGG - Intergenic
1110329331 13:74252761-74252783 ATGGGGAAGAGAAGGGAGGATGG - Intergenic
1110465551 13:75796812-75796834 AAGGAGAAGAAAAAGAAGAGAGG - Intronic
1110744428 13:79036360-79036382 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1110870219 13:80443539-80443561 AAGGAGGAGAAAAAGAAGAAAGG - Intergenic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1110904441 13:80867860-80867882 AAGGAGAAAATAAAGGAGAATGG + Intergenic
1110932828 13:81244297-81244319 ATGCAGCATATAAAAAAGGAAGG - Intergenic
1110965531 13:81690225-81690247 ATGAAGAAGAGGAAGAAGGTGGG + Intergenic
1111086385 13:83380589-83380611 AGGGGGAAGAGAAGGAAGGAAGG - Intergenic
1111086438 13:83380751-83380773 AGGGAGAGGAGAAGGAAGGAAGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111285167 13:86081601-86081623 ATGGATCAAATAAAAAAGGAGGG + Intergenic
1111394151 13:87642904-87642926 ATTGAGAAGATACAAAAGGAAGG + Intergenic
1111545504 13:89728629-89728651 ATTGAGAAGAAAAACAAGGTAGG - Intergenic
1111563463 13:89983598-89983620 AGGAAGAAAAGAAAGAAGGAAGG - Intergenic
1111613868 13:90640060-90640082 ATGAAGAAAGGAAAGAAGGAAGG - Intergenic
1111706523 13:91756399-91756421 ATGGAGAAGATATAGTAAAAAGG + Exonic
1111904253 13:94237299-94237321 ATGGAGAAAAGAAAGAAGGAAGG - Intronic
1112643175 13:101300331-101300353 AAGAAAAAGAAAAAGAAGGAAGG - Intronic
1113117355 13:106887387-106887409 ATGGACAGGAAAAAGAAGGTTGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113616821 13:111686090-111686112 ATTTGGAAGATAAAGAATGATGG - Intergenic
1113622351 13:111771361-111771383 ATTTGGAAGATAAAGAATGATGG - Intergenic
1113674035 13:112196039-112196061 AGGGAGAAAGGAAAGAAGGAAGG - Intergenic
1114252386 14:20972322-20972344 ATGGAAAAAATAAAGCAGGAAGG + Intergenic
1114739532 14:25081051-25081073 AAAGAAAAGAAAAAGAAGGAAGG - Intergenic
1114854764 14:26424833-26424855 AGGGAGAAGGGAAGGAAGGAAGG - Intergenic
1115084268 14:29494490-29494512 AGGGAGAAAAGAAGGAAGGAAGG + Intergenic
1115344441 14:32327387-32327409 CTGGAGAAGATAAAGAGACATGG - Intergenic
1115467110 14:33727623-33727645 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1115617848 14:35113298-35113320 ATGGAGAGGAAGAAGAAAGAAGG + Intronic
1115952312 14:38734966-38734988 CTAAAGAAGAAAAAGAAGGAGGG + Intergenic
1116010621 14:39347407-39347429 AGGGAGGAGGAAAAGAAGGAAGG + Intronic
1116123736 14:40755109-40755131 ATGGAAAACAGAAAAAAGGAGGG - Intergenic
1116433750 14:44874558-44874580 AGAGAGAGGAAAAAGAAGGAAGG + Intergenic
1116585053 14:46693063-46693085 ATGGGAAGGACAAAGAAGGAAGG - Intergenic
1116688544 14:48074782-48074804 AAGGAGACTAAAAAGAAGGAAGG - Intergenic
1117022094 14:51581244-51581266 AGGTAGTAGATAAAGAAAGATGG - Intronic
1117087349 14:52215209-52215231 AAGGAGGAAAGAAAGAAGGAGGG + Intergenic
1117261260 14:54036004-54036026 TAAAAGAAGATAAAGAAGGAGGG + Intergenic
1117265340 14:54080486-54080508 ATGGGGAAGAGAAATATGGATGG - Intergenic
1117396726 14:55317983-55318005 AAGTAGAAGATAAAACAGGAGGG - Intronic
1117506725 14:56411757-56411779 AAGGAGAAGAAGAAGAAGAACGG + Intergenic
1117730800 14:58719991-58720013 ATGGAGAAGGCAAAAATGGAAGG + Intergenic
1117797794 14:59411755-59411777 ATGGAAAACAAAAAAAAGGAAGG + Intergenic
1117959666 14:61150197-61150219 AAAGAAAAGAAAAAGAAGGAGGG - Intergenic
1118213943 14:63790356-63790378 AAGAAGAAAAGAAAGAAGGAAGG + Intergenic
1118346232 14:64943047-64943069 ATGGAGAGGAAAAAAAGGGAGGG + Intronic
1118426047 14:65663677-65663699 ATAGAGGACATAAAGAAAGAGGG - Intronic
1118554939 14:67007878-67007900 ATGGAGAAAATAAAAAAGGGAGG + Intronic
1119186888 14:72649471-72649493 AGTGAGAAGAGGAAGAAGGAAGG + Intronic
1119246268 14:73111170-73111192 GGGAAGAAAATAAAGAAGGAAGG - Intronic
1119258651 14:73222693-73222715 TTAGAGAAGTTAAAGAAAGATGG - Exonic
1119531886 14:75367557-75367579 ATGAAGAAGGAAAAAAAGGAAGG + Intergenic
1119680006 14:76585104-76585126 TGGGAGAAGGGAAAGAAGGAGGG + Intergenic
1119829620 14:77690021-77690043 AGCAAGAAGATAAAGAATGAGGG + Intronic
1119887694 14:78157171-78157193 ATGGAGAGGAGGAAGTAGGAGGG + Intergenic
1120242976 14:81971611-81971633 AAGAAGAAGAAAAAGAAGGAAGG - Intergenic
1120476400 14:84993520-84993542 CTAGAGAAGATAAAAAAGGAAGG - Intergenic
1120576012 14:86181620-86181642 ATGGAGATGATAAAAATGAAGGG - Intergenic
1120626176 14:86829531-86829553 AGGGAGAAGAGAGAGAGGGAGGG + Intergenic
1121038618 14:90727049-90727071 AAGGAGAAGAAAAAGAGGGGTGG + Intronic
1121042449 14:90760204-90760226 ATGGAGAAGATAAACAGAGGTGG + Intronic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121141357 14:91545271-91545293 ATGGAAAAGAGAGAGAAAGAAGG - Intergenic
1121141375 14:91545386-91545408 ATGGAAAAGAAAAAGAAAGAAGG - Intergenic
1121589262 14:95088804-95088826 ATGATGCAGATAAAGCAGGAAGG + Exonic
1121916727 14:97842361-97842383 AGGGAGGAGGGAAAGAAGGAAGG + Intergenic
1121916746 14:97842437-97842459 AGGGAGGAGGCAAAGAAGGAAGG + Intergenic
1121916758 14:97842469-97842491 AGGGAGGAGGGAAAGAAGGAAGG + Intergenic
1121929270 14:97957593-97957615 AGAGAGAAGAGAAGGAAGGAAGG - Intronic
1122322286 14:100862253-100862275 AAGGAGAAGAAAAAGAGAGAGGG - Intergenic
1122392529 14:101399959-101399981 AGGGAGAAAGGAAAGAAGGAAGG + Intergenic
1122570170 14:102692748-102692770 AAGAAAAAGAAAAAGAAGGAAGG - Intronic
1123093630 14:105753736-105753758 AGGCAGAAGAGAAGGAAGGAAGG - Intergenic
1123756664 15:23402281-23402303 AAGGAGAAAGGAAAGAAGGAAGG + Intergenic
1124049340 15:26180432-26180454 ATGGAGTTGATAAAGGAAGAAGG + Intergenic
1124932223 15:34131775-34131797 TAGGAGAAAATAAAGAAGGGTGG - Intergenic
1125005863 15:34816935-34816957 CTGGAGAAGAGAAAAAAGGGGGG + Intergenic
1125049738 15:35283085-35283107 AGGGAGAAGAAGAAGAAAGAAGG - Intronic
1125120161 15:36146965-36146987 ATGGAGAAGAGAAAGAGAAAAGG + Intergenic
1125144546 15:36451542-36451564 ATGAAAAAGATAAAAGAGGAAGG - Intergenic
1125299382 15:38238282-38238304 AGGGAGAAAAGAAAGAAGTAAGG - Intergenic
1125826768 15:42683058-42683080 ATGGAGAAAAGAAACAAGGAAGG - Intronic
1126012755 15:44318959-44318981 AGGGAGAAGATAAGGAAGAAAGG - Intronic
1126123616 15:45275417-45275439 AGGGACCAGAAAAAGAAGGAGGG - Exonic
1126205173 15:46037156-46037178 TTTGACAAGATAAATAAGGAGGG - Intergenic
1127052080 15:55094962-55094984 ATGAAGAAGATGAAGAGGGAGGG - Intergenic
1127363369 15:58264663-58264685 AGGGAGAAGAGGGAGAAGGAGGG - Intronic
1127700166 15:61491555-61491577 ATGGAGAACAGAGAGAAGAATGG - Intergenic
1127747434 15:61994217-61994239 ATGCAGTAGACAAAGAAGGATGG - Intronic
1127813650 15:62586982-62587004 ATGGAAAAGAGAAAGATAGATGG + Intronic
1127889645 15:63238302-63238324 CTGGAGACTAGAAAGAAGGAGGG - Intronic
1127954339 15:63840026-63840048 AGGGAGAAGGGAAAGAAGAAGGG + Intergenic
1128053702 15:64684398-64684420 GAGGAGAAGCTAAAGAGGGAGGG + Exonic
1128103392 15:65024795-65024817 ATGGAGAAAATAAAGCAGAGAGG + Intronic
1128586653 15:68858155-68858177 AAGGAGAGGAAAAAGAAAGATGG - Intronic
1128899003 15:71402257-71402279 AGGGAGAGGATAATGAAAGAGGG - Intronic
1129026574 15:72580568-72580590 TTGGCAAAGATAAAGAAAGAAGG - Intronic
1129057985 15:72835720-72835742 AGGGAGGAGATAAGGGAGGAGGG + Intergenic
1129521502 15:76189331-76189353 AGGGAGCAGAGAAAGAAGGAGGG + Intronic
1129622328 15:77159636-77159658 ATGAAAAAAAGAAAGAAGGAAGG + Intronic
1129876961 15:78981952-78981974 ATGGAGAAGAAAAGGAAGGAGGG - Intronic
1129917795 15:79289669-79289691 AAGGAGAAGGAAAAGAAGGTGGG - Intergenic
1129932603 15:79424876-79424898 GTGGAGAAGAAATAGAAGGAAGG + Intronic
1130072691 15:80661808-80661830 ATGGAGAGTAGAAAGAAGGGTGG - Intergenic
1130866244 15:87935563-87935585 ATGCAGAAGAAGAAGAAGAAGGG + Intronic
1130924672 15:88375956-88375978 ATGAGGAAGAGAAGGAAGGAGGG - Intergenic
1130987551 15:88854661-88854683 ATGAAGAAAGGAAAGAAGGAAGG - Intronic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131321113 15:91392103-91392125 CTGGAGAAGACAAATATGGATGG + Intergenic
1131359018 15:91772754-91772776 GCGGAGAAGAGAAAGAGGGAAGG - Intergenic
1131744725 15:95434853-95434875 AGGAAGAAGAAAAAGAAGGAAGG - Intergenic
1131769228 15:95716832-95716854 AAGCAAAAGAGAAAGAAGGAAGG + Intergenic
1131833300 15:96367829-96367851 AAGGAGAAAATTCAGAAGGAAGG + Intergenic
1131981267 15:97997062-97997084 ATGCAGAAAATAAAGAAAGATGG + Intergenic
1132091173 15:98949003-98949025 ATGGAGAGGATGAGTAAGGATGG - Intronic
1132304487 15:100801565-100801587 CTGGAGAAGAGAAGGAAGGCAGG + Intergenic
1132772117 16:1569473-1569495 AGGGAGGAGGGAAAGAAGGAAGG - Intronic
1133184763 16:4087836-4087858 AAAGAAAAGAGAAAGAAGGAAGG - Intronic
1133371335 16:5247992-5248014 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1133389959 16:5402223-5402245 CTGGAGAAGATCTGGAAGGAAGG + Intergenic
1133569622 16:7027917-7027939 AGGGAAAAGAGAAGGAAGGAGGG + Intronic
1133588378 16:7217542-7217564 AGGGATAAGATAAAGAGTGATGG - Intronic
1133702072 16:8318080-8318102 CTCTAGAAGACAAAGAAGGAGGG - Intergenic
1134019480 16:10911526-10911548 AAGGAAAGGAAAAAGAAGGAAGG - Intronic
1134081538 16:11328181-11328203 ATGAAGAAAATAAACCAGGAGGG - Intronic
1134120802 16:11583587-11583609 GTGTGGAAGATAAAGAAGAAAGG - Intronic
1134459672 16:14420459-14420481 AAGGAGAAAGGAAAGAAGGAAGG - Intergenic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1134652249 16:15919072-15919094 AAGGAAGAGAGAAAGAAGGAAGG - Intergenic
1134800174 16:17077002-17077024 GTGGAGAAGGTAAAGGGGGAAGG - Intergenic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1135067316 16:19321321-19321343 AGAGAGAAGAAAAAGAAAGAAGG - Intronic
1135200173 16:20430546-20430568 AGGAAGAAAATGAAGAAGGAAGG + Intronic
1135251287 16:20902379-20902401 TTGGAGATAATAAATAAGGAAGG + Intronic
1135547804 16:23377525-23377547 ATAAAGCAGAGAAAGAAGGAAGG - Intronic
1135637683 16:24093057-24093079 ATGGAGAAGACAGAAAAGGAGGG - Intronic
1135641701 16:24125339-24125361 ATGGGGAGGAGAAAGAAGAAAGG - Intronic
1135913147 16:26579214-26579236 AAGGAGGAGAAGAAGAAGGAAGG - Intergenic
1135923833 16:26674702-26674724 ATGGGGAAGAGAAAGAGGGGTGG + Intergenic
1136044442 16:27604039-27604061 ATGGAGAATAGAAAGTGGGAAGG - Intronic
1137042266 16:35624012-35624034 AAAGAGAAAAGAAAGAAGGAAGG - Intergenic
1137219770 16:46437160-46437182 AAGGAAAAGGAAAAGAAGGAAGG - Intergenic
1137378073 16:47971776-47971798 AGGGAGAAAAGCAAGAAGGAAGG - Intergenic
1137570906 16:49565847-49565869 ATGGAAAAGATAAGGATGGAAGG + Intronic
1137821527 16:51449922-51449944 AGTGAGAAGAGAAAGCAGGAAGG - Intergenic
1137863686 16:51871795-51871817 AAGGAGAAGAGAAGGAAGGAGGG + Intergenic
1138103593 16:54274444-54274466 AGGAAGAAAAGAAAGAAGGAAGG - Intergenic
1138289596 16:55835595-55835617 AAGGAGAAGAAGGAGAAGGAGGG + Intergenic
1138600555 16:58051578-58051600 AGGGAGGGAATAAAGAAGGAAGG + Intergenic
1138646274 16:58427361-58427383 CTGCAAAAGAGAAAGAAGGAAGG - Intergenic
1138777744 16:59744591-59744613 ATAGAGAAGGAAAGGAAGGAAGG - Intronic
1139189020 16:64840176-64840198 ATGAAGAAGACAGAGAAAGAGGG + Intergenic
1139195391 16:64912694-64912716 GTTTAGAAGATAAAGAGGGACGG + Intergenic
1139268241 16:65659430-65659452 ATGGAGAAGGTGCAGAGGGATGG + Intergenic
1139284957 16:65804429-65804451 ATGAAGGAGAGAAAGAAGAAAGG + Intergenic
1139605162 16:68013062-68013084 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1139656450 16:68389935-68389957 TTAGAGAAGAAACAGAAGGATGG + Intronic
1139675861 16:68523119-68523141 AAGGACAGGATAGAGAAGGAGGG - Intergenic
1140269918 16:73456360-73456382 CAGAAGAAGATAAAGGAGGAAGG - Intergenic
1140328231 16:74026867-74026889 AGGAAGAAGAAAAAGAAGAAAGG + Intergenic
1140692608 16:77498795-77498817 AGGGAGAAAAGAAAGAAAGAAGG + Intergenic
1140695365 16:77527278-77527300 ATGGAAAACAAAAAAAAGGAGGG + Intergenic
1140836236 16:78796807-78796829 AAGAAGAAGATAAAGAAACATGG - Intronic
1140903589 16:79392214-79392236 AAGAAAAAGAGAAAGAAGGAGGG + Intergenic
1141275545 16:82584645-82584667 ATGGAGAAGAAGAAGAAGTAGGG + Intergenic
1141296695 16:82776267-82776289 AGAGGGAAGAAAAAGAAGGAAGG + Intronic
1141307797 16:82882641-82882663 AGGGAGAACGGAAAGAAGGAAGG - Intronic
1141411643 16:83838262-83838284 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
1141803878 16:86329820-86329842 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1141856222 16:86683103-86683125 GGGGAGAAGGAAAAGAAGGAAGG + Intergenic
1142526232 17:543774-543796 ATGAAGAAGAGAAGGAAGGAAGG + Intronic
1143331875 17:6143371-6143393 ATGGAGGAGCTAGAGATGGATGG - Intergenic
1143864702 17:9915742-9915764 ATGGGAAAGATGAAGAAAGATGG + Exonic
1144356979 17:14455562-14455584 AAGGAGAAGATGAAAAAGAAGGG - Intergenic
1144465767 17:15496060-15496082 ATGGAGGAGAGAAAGATGAAGGG - Intronic
1144518522 17:15938175-15938197 AGAGAGAAAAAAAAGAAGGAAGG + Intergenic
1144612948 17:16740877-16740899 ATAAGGAAGATGAAGAAGGAAGG - Intronic
1144690456 17:17259040-17259062 ATGGAGAAGCTAGAGAAGAGAGG - Intronic
1144741624 17:17586176-17586198 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1144899834 17:18574715-18574737 ATAAGGAAGATGAAGAAGGAAGG + Intergenic
1145098352 17:20051758-20051780 ATGGAGAAAATCAAGTAGGGTGG + Intronic
1145202216 17:20956575-20956597 ATGGAGAAGATAAAGCTGAAAGG - Intergenic
1146320895 17:31845525-31845547 ATGGAGAGGAGAATGAAGGAGGG + Intergenic
1146538189 17:33671522-33671544 ATGGGAAAGACAAGGAAGGAGGG + Intronic
1146978251 17:37134974-37134996 AGGGACAAAAGAAAGAAGGAAGG + Intronic
1147361860 17:39935900-39935922 ATAGAGAAGATAGATAAGGAAGG - Intergenic
1147364337 17:39950651-39950673 ATGGAGATGCTGAAGAAGGGGGG + Intergenic
1147498720 17:40942204-40942226 AAGGAGAAGAAGGAGAAGGAGGG - Intergenic
1147621593 17:41871726-41871748 GTGAACAAGATGAAGAAGGAAGG - Exonic
1148204909 17:45774175-45774197 ATCCAGAAGAGAAGGAAGGAAGG + Intergenic
1148514269 17:48201312-48201334 AGGGAGGAGAGAAGGAAGGAAGG - Intronic
1149025340 17:52020801-52020823 CTGGAGGGGGTAAAGAAGGATGG - Intronic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149249697 17:54754246-54754268 ATAGAGCAGAAAAAGAAGGCTGG - Intergenic
1149441215 17:56675676-56675698 ATGATGAAGATAAATAAGAAGGG - Intergenic
1149503486 17:57173216-57173238 AAGGAGGAGAGAAGGAAGGAAGG - Intergenic
1149814222 17:59707255-59707277 AAGGAGAAAATGAAGAAGGTGGG + Intronic
1150067378 17:62122942-62122964 AAGGAGAAAAGAAGGAAGGAAGG + Intergenic
1150072124 17:62160050-62160072 AGAGAGAAGAAAGAGAAGGAAGG + Intergenic
1150466829 17:65400698-65400720 AAGGAGAAACAAAAGAAGGAAGG - Intergenic
1150576252 17:66433474-66433496 ATGGAGTAGCTAAAGGAGCAGGG + Intronic
1150802636 17:68293950-68293972 CTGGAGAAGTTAAAAAAGCAGGG - Intronic
1150810005 17:68348746-68348768 TTGGAGAAGAGATAGAATGAAGG + Intronic
1150810282 17:68350838-68350860 CTGGAGAAGAGATAGAAGGAAGG + Intronic
1150841667 17:68613302-68613324 ATAGGGAAGAGGAAGAAGGAAGG - Intergenic
1150851356 17:68706811-68706833 ATGGAGGAGGGAAAGAAAGAAGG - Intergenic
1150915401 17:69431657-69431679 ATAGACCAGATAAAGAAAGAGGG - Intronic
1150918496 17:69459945-69459967 AGGGAGAAGGAAAGGAAGGAAGG - Intronic
1150974830 17:70073566-70073588 ATGGAGAAGAGCAAGACGGGAGG - Intronic
1151024944 17:70667453-70667475 ATGCATAAGTTAAATAAGGAAGG - Intergenic
1151029297 17:70717582-70717604 ATGAAGAAGAAAAAAAATGATGG - Intergenic
1151083819 17:71358575-71358597 AATGAGAAGATGTAGAAGGAAGG + Intergenic
1151195274 17:72426674-72426696 ATGATAAAGATAAATAAGGAAGG + Intergenic
1151257213 17:72887214-72887236 ATGGATCAGATAATGAATGAAGG + Intronic
1151327640 17:73388873-73388895 AGGGAGAAGGAAGAGAAGGAGGG - Intronic
1151436825 17:74102849-74102871 GAGGAGAAGACAAAGAAGAAGGG + Intergenic
1151503526 17:74510124-74510146 AAGAAGAAAAGAAAGAAGGAAGG - Intergenic
1151764131 17:76123366-76123388 CTGAAAAAGAAAAAGAAGGAAGG - Intergenic
1151918394 17:77135862-77135884 ATAGAAAAGAAAGAGAAGGAAGG - Intronic
1152038165 17:77885862-77885884 AGGGAGAAAGGAAAGAAGGAAGG + Intergenic
1152148039 17:78581011-78581033 AGGCAGAAGCTGAAGAAGGATGG - Intergenic
1152271566 17:79327992-79328014 ATAGATAAGAGAGAGAAGGAAGG - Intronic
1152315933 17:79580219-79580241 ATGGAGATGATAATGATGGTGGG - Intergenic
1152412793 17:80137690-80137712 ATGGAGAAAATGAAGTAAGAGGG - Intronic
1153182523 18:2451086-2451108 GGGAAGAAGAAAAAGAAGGAAGG + Intergenic
1153261093 18:3225317-3225339 ATTGAGAAGAGAGAGAAGTATGG - Intergenic
1153356978 18:4148051-4148073 ATGGAAAAGAGAGACAAGGATGG - Intronic
1153410954 18:4791904-4791926 ATGGAAAAGAGAAAAAAGCAAGG + Intergenic
1153725664 18:7952356-7952378 ATGAAAGAGGTAAAGAAGGAAGG - Intronic
1154339698 18:13492763-13492785 ATGGAGAAAATGAGGAAGGGGGG - Intronic
1155380852 18:25220367-25220389 AAGGAGAAGAGAAAGAAGACAGG + Intronic
1155485555 18:26338109-26338131 ATGGATAAGATTAGGAATGAAGG - Intronic
1155797382 18:30057563-30057585 AAGGAGAAGGGAAGGAAGGAAGG - Intergenic
1155797396 18:30057663-30057685 AAGGAGAAGGGAAGGAAGGAAGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156036706 18:32772465-32772487 AGGGAGAAGAACAAGAAGGAAGG - Intronic
1156177341 18:34562505-34562527 ATGGTAAAGAAAAAAAAGGAAGG - Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156472287 18:37384792-37384814 AAGGAGCAGATAAAGCAGGAGGG - Intronic
1156511337 18:37639465-37639487 AGGAAGAAGAGGAAGAAGGAAGG - Intergenic
1156691988 18:39719379-39719401 ATGGAGAAGATAAACAATTAAGG - Intergenic
1156708113 18:39908465-39908487 ATTGCAAAGATAAAGAAGAATGG - Intergenic
1156753741 18:40494699-40494721 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1156764342 18:40633113-40633135 ATGAAGAAAGGAAAGAAGGAAGG + Intergenic
1156777310 18:40807692-40807714 TTGGAGAAGAGAGAGAGGGAGGG - Intergenic
1156843738 18:41639086-41639108 AGGGACAGGAAAAAGAAGGAAGG + Intergenic
1157134034 18:45036702-45036724 ATGGAGAATAGGAGGAAGGAAGG + Intronic
1157358355 18:46955533-46955555 ATGAAAGAAATAAAGAAGGAAGG - Intronic
1157369634 18:47098995-47099017 AAGGAGAAGAAAGAGAAGGAAGG - Intronic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1157763301 18:50280702-50280724 AAGGAGAAGAAAAATAAGGGGGG - Intronic
1158273128 18:55738096-55738118 AGGGAGAAAATAAAGGAGAAAGG - Intergenic
1158340581 18:56461585-56461607 ATGGTGTAGAGAAAGAATGATGG - Intergenic
1158420313 18:57287351-57287373 TTGGAGAAGATGGAGTAGGAGGG - Intergenic
1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG + Intergenic
1158540191 18:58346580-58346602 ATGGAAAAGATAAAGAAAAAAGG + Intronic
1158739401 18:60122606-60122628 AAGGAGAAGATAAGAAAGGAAGG - Intergenic
1159015841 18:63101223-63101245 ATGGCCAAGAAAAAGAAGGCAGG + Intergenic
1159150632 18:64518742-64518764 AAGGAGAAGGAAAGGAAGGAGGG - Intergenic
1159238073 18:65703426-65703448 AGGGAGAAGAGAAACAAGGAGGG + Intergenic
1159238956 18:65715184-65715206 CTGGAAAAGATAAAGAAAGGAGG + Intergenic
1159725060 18:71946983-71947005 AGGAAGAAAGTAAAGAAGGAGGG - Intergenic
1159785206 18:72705311-72705333 ATGGAGAGAAGAAAGAAGGCAGG + Intergenic
1160239687 18:77114148-77114170 AGGCAGAAGAAAACGAAGGATGG - Intronic
1160356183 18:78229797-78229819 ATGAAGAAGAGAAAGGAGGGAGG - Intergenic
1160422612 18:78757616-78757638 AGGGAGGAAAGAAAGAAGGAAGG - Intergenic
1161277715 19:3428188-3428210 AAAGAAAAGAAAAAGAAGGAAGG + Intronic
1161529404 19:4778321-4778343 AAGGAAGAGAGAAAGAAGGAAGG - Intergenic
1161631068 19:5355820-5355842 ATGGAGAAGAGAGGAAAGGAGGG - Intergenic
1161647589 19:5463381-5463403 AAGGAGAAGGAAAAGAAGAAAGG - Intergenic
1161918332 19:7247399-7247421 ATCGAGAAGAGGAACAAGGAAGG - Intronic
1161946765 19:7442161-7442183 AAGAAAAAGATAAGGAAGGAAGG - Intronic
1161958008 19:7506885-7506907 AGGGAGGAGCCAAAGAAGGAGGG - Intronic
1161960115 19:7518492-7518514 AGGAAGAAGAGAGAGAAGGAAGG + Intronic
1162203745 19:9040206-9040228 AGGGAGAAGATAGAAGAGGAAGG + Intergenic
1162269685 19:9604012-9604034 AAGGAGGAAAGAAAGAAGGAAGG + Intergenic
1163137262 19:15321272-15321294 AAGAAAAAGAGAAAGAAGGAAGG + Intronic
1163468640 19:17484284-17484306 AAGGAGATAATAAATAAGGATGG + Intronic
1163549424 19:17957274-17957296 AGGGAGAAGAGAGAGAGGGAGGG + Intronic
1164439978 19:28269287-28269309 AAAGAGAAGAGAAAGAAGGAAGG - Intergenic
1164763183 19:30743568-30743590 AAGGAGAGGAGGAAGAAGGAAGG - Intergenic
1164788032 19:30952266-30952288 AGGGAGGAAAGAAAGAAGGAAGG - Intergenic
1164788040 19:30952309-30952331 AGGGAGGAAAGAAAGAAGGAAGG - Intergenic
1164802346 19:31088139-31088161 AAGAAAAAGAGAAAGAAGGAAGG + Intergenic
1164843747 19:31414265-31414287 GTGGAGATGCTAAAGATGGAAGG + Intergenic
1164940467 19:32249143-32249165 ATGAGGGAGATAAAGAAAGAAGG + Intergenic
1165100566 19:33436271-33436293 AGTGAGAAGAGAAAGAAGCATGG + Intronic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1166132044 19:40751460-40751482 AATGAGAAGATCAAGAAGGATGG + Exonic
1166353296 19:42211390-42211412 AGGGAGAAGAAAAGGAAGGAAGG + Intronic
1166394002 19:42425476-42425498 AGGTAGAAAATAAAGAAGTAAGG - Intronic
1166548578 19:43649659-43649681 AAGGAGAAGGGAAAGAAGGAAGG + Intronic
1167181100 19:47904000-47904022 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167181768 19:47909359-47909381 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167182418 19:47914749-47914771 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167183085 19:47920101-47920123 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167183753 19:47925451-47925473 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167184383 19:47930501-47930523 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167185055 19:47935852-47935874 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167185707 19:47941241-47941263 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167186374 19:47946599-47946621 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167187025 19:47951987-47952009 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167187675 19:47957370-47957392 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167542166 19:50096262-50096284 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167542601 19:50099327-50099349 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167543038 19:50102392-50102414 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167543474 19:50105455-50105477 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167544147 19:50110799-50110821 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167544822 19:50116152-50116174 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167545497 19:50121504-50121526 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167546174 19:50126832-50126854 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167546851 19:50132167-50132189 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167547509 19:50137540-50137562 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167845913 19:52164018-52164040 AAGGAAAAGAAAAAGAAGGAAGG + Intronic
1168059848 19:53884682-53884704 ATGGAGCAGAGAAAGAACCAGGG + Intronic
1168289693 19:55351596-55351618 AAGGAGTAGAGAAAGAAGGCGGG + Intronic
1202697366 1_KI270712v1_random:134887-134909 ATGGAGGAGAAAAAGAAGTGAGG - Intergenic
925107715 2:1307466-1307488 AGAGAGAAGAGAGAGAAGGAGGG + Intronic
925221975 2:2149099-2149121 AGGAAGAAAATAAGGAAGGAGGG - Intronic
925441034 2:3885466-3885488 ATGAAGAAGTGAAAGGAGGAAGG - Intergenic
925442085 2:3897276-3897298 ATGGAAAACAGAAAAAAGGAGGG - Intergenic
925680256 2:6413071-6413093 ATGAAGGAGAAAAGGAAGGAAGG + Intergenic
925697751 2:6599137-6599159 AAGAAGAAGAAAAAGAAAGAAGG + Intergenic
925842592 2:8006585-8006607 AGGGAGGAGGAAAAGAAGGATGG - Intergenic
925930986 2:8707760-8707782 AAGGAGATGAAAAAGAATGAGGG - Intergenic
925984389 2:9204307-9204329 AAGGCGAAGAAAAAGGAGGAAGG - Intergenic
926300788 2:11600640-11600662 ATAGAGAAAATAAAAAAGGCTGG - Intronic
926433869 2:12818361-12818383 AGGGAGAAGGGAAGGAAGGAAGG - Intergenic
926484200 2:13434419-13434441 ATGGGGAAGAGAGAGAAAGAGGG - Intergenic
926828785 2:16937170-16937192 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
926843557 2:17108439-17108461 AGGGAGGAGAAAGAGAAGGATGG + Intergenic
926938548 2:18112001-18112023 ATGGAGAAGATAAAGATGGGAGG + Intronic
927173796 2:20391608-20391630 ATGGAGAAGATAGGCAGGGAAGG - Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
928667444 2:33564088-33564110 ATGGAGAAAAGAAAGGAGAAAGG - Exonic
928745403 2:34408061-34408083 ATGGGAAAGATAAAGGAGAATGG + Intergenic
928921692 2:36534207-36534229 ATGGGAAAGATAAGGAAGGAAGG + Intronic
929042913 2:37762949-37762971 AGAGAGAAAATAAAGAAGAAAGG + Intergenic
929172957 2:38949585-38949607 ATGGAGAAGAGAGGGATGGAAGG + Intronic
929239332 2:39637515-39637537 ATGGAGAACATAAAGATTGAGGG - Intergenic
929365285 2:41147130-41147152 GTGGAAAAGATGAAGAAGGCAGG + Intergenic
929548018 2:42868758-42868780 AAGGAAAACAGAAAGAAGGAGGG - Intergenic
929593196 2:43160067-43160089 AGGGAGGAGAAAAAGGAGGAGGG - Intergenic
929794079 2:45045435-45045457 AGGGAGGAGAGGAAGAAGGAAGG - Intergenic
929850300 2:45581760-45581782 ATCCAGAAAATTAAGAAGGAAGG - Exonic
929865845 2:45716681-45716703 AAGAAGAAGAGAAGGAAGGAAGG + Intronic
929879639 2:45824605-45824627 AAGGAGGAGAAAAAGAAGGGAGG - Intronic
929981648 2:46686989-46687011 CTGGTGAAGTTAAAGAAGGAAGG - Intergenic
930047153 2:47182791-47182813 ATGGAGAAGAGAAAGAAGATGGG - Intergenic
930307926 2:49699853-49699875 TTGGAGAAGCCTAAGAAGGATGG - Intergenic
930484340 2:51993734-51993756 AAGAAGAACATAAGGAAGGAAGG + Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930753207 2:54951898-54951920 ATGGTGTAGATACACAAGGAAGG - Intronic
930836650 2:55801223-55801245 CTGGAGAAAACAAAAAAGGAGGG - Intergenic
931061824 2:58537939-58537961 ATGGATTAGATAAAGGGGGATGG - Intergenic
931080707 2:58766903-58766925 TTAGAAAAGAAAAAGAAGGAGGG - Intergenic
931152645 2:59592110-59592132 GTGGAGAAGAGAAAGAAGAAAGG + Intergenic
931190217 2:59992955-59992977 ATTGAGAAGATAAATAAAAATGG + Intergenic
931231650 2:60380207-60380229 ATGGAAGACATAAAGATGGATGG + Intergenic
931660868 2:64561112-64561134 ATAGAGAAAATGAAAAAGGAGGG + Intronic
931673798 2:64673153-64673175 CTGGAAAAGACAATGAAGGAGGG - Intronic
931796152 2:65712148-65712170 AAGGGGAAGGGAAAGAAGGAAGG - Intergenic
931921400 2:67020140-67020162 ATGGAGAAAAGAAAAAAGCAGGG + Intergenic
931999789 2:67874159-67874181 ACGAAGAAGACAAAAAAGGATGG - Intergenic
932094062 2:68831384-68831406 AGGGAGAACAGAGAGAAGGAAGG - Intergenic
932281493 2:70496702-70496724 ATGAAGGAAGTAAAGAAGGAAGG - Intronic
932766012 2:74470638-74470660 ATAGAGAAGAAAAAGAATGAAGG + Intergenic
933018133 2:77157261-77157283 AGGGAGAAAGTGAAGAAGGAAGG + Intronic
933030989 2:77328463-77328485 AGGAAGAAAAGAAAGAAGGAAGG - Intronic
933069349 2:77837121-77837143 AGGAAGAAGAGAGAGAAGGAAGG + Intergenic
933096739 2:78192904-78192926 AAGGAGAAGAAAAAGAAAAAGGG + Intergenic
933214882 2:79618609-79618631 TTGGAGAAGAAAAACAAGAATGG - Intronic
933401834 2:81808403-81808425 TTGGAGATTATAAAGAAAGATGG + Intergenic
933481374 2:82861217-82861239 GAGGAGGAGAAAAAGAAGGAAGG - Intergenic
933539017 2:83615533-83615555 ATGAAGAAGATAAAGAAAGGAGG + Intergenic
933606156 2:84386227-84386249 ATGGATAAGCTGTAGAAGGAAGG + Intergenic
933646482 2:84816988-84817010 AAGGAGAAAATAAAGAATGGAGG + Intronic
934070197 2:88376854-88376876 AGGGAGCAGGCAAAGAAGGATGG - Intergenic
934278534 2:91591912-91591934 ATGGAGGAGAAAAAGAAGTGAGG - Intergenic
934873072 2:97885873-97885895 AAGGAGAAGAGAAAGGAGAAAGG - Intronic
934895009 2:98110107-98110129 AAGGAGAAGAGAAAGAGGGTAGG - Intronic
934903250 2:98177559-98177581 AAGGAGAAAAAAAAAAAGGAGGG - Intronic
935206000 2:100896833-100896855 ATGAAGAAGAAAAGGAAGGGAGG - Intronic
935490585 2:103715903-103715925 ATGGAGAATAGAAAAAAGCAAGG + Intergenic
935544759 2:104389124-104389146 ATGGAGAAGATGAAGAGAAAAGG + Intergenic
935598897 2:104902070-104902092 TTGGAGGAGAGAAAGAGGGAGGG - Intergenic
935809169 2:106779908-106779930 AAGGAGAAGAAAAAGAATGCTGG + Intergenic
935852717 2:107240424-107240446 ATGGAAATGATAAACAAGCATGG + Intergenic
936655288 2:114478568-114478590 AAGGAAAAAATAAATAAGGAAGG + Intronic
936807983 2:116360185-116360207 ATGGAAAACAAAAAGAAGCAGGG + Intergenic
936843869 2:116806454-116806476 ATGATGAAGAAAAAGAAGGCAGG + Intergenic
936990921 2:118365182-118365204 ATGTAGAAGTTAATGAAAGAAGG - Intergenic
937071374 2:119066230-119066252 AAGAAGAAAATAACGAAGGAAGG - Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937440518 2:121911505-121911527 ATGATGAAGAAAATGAAGGATGG + Intergenic
937520109 2:122703381-122703403 AAGGAGAAGAAAAAGAGGGGAGG + Intergenic
937535059 2:122876100-122876122 ATGGAGAAGATAGAGGAGGGTGG - Intergenic
937633112 2:124125231-124125253 ATGGAGAACAAAAAAAAGCAAGG + Intronic
938275190 2:130014314-130014336 ATGAAGGAGTGAAAGAAGGAAGG - Intergenic
938326149 2:130405038-130405060 ATGAAGGAGTGAAAGAAGGAAGG - Intergenic
938363790 2:130716421-130716443 ATGAAGGAGTGAAAGAAGGAAGG + Intergenic
938440173 2:131322966-131322988 ATGAAGGAGTGAAAGAAGGAAGG + Intronic
939069454 2:137521492-137521514 AATGAGAAGAAAAAGAGGGATGG - Intronic
939203890 2:139074785-139074807 ATGAAAAAGAAAAAGAAGCAGGG - Intergenic
939204188 2:139078794-139078816 ATGAAAAAGCAAAAGAAGGAGGG - Intergenic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
939733829 2:145819236-145819258 AGGGAGAAAAGAAGGAAGGAAGG - Intergenic
939901069 2:147850163-147850185 AGGGAGTAGACAAAGAAGGGAGG - Intronic
940275127 2:151932074-151932096 TTGGAGAAGATAAAAATGGAAGG + Intronic
940489514 2:154340192-154340214 AAGTAGAACATAAAGAATGAGGG - Intronic
941209645 2:162621434-162621456 ATGGGGAAGAGAAAGAGGGCTGG + Intronic
941293080 2:163700372-163700394 TTGAAGAAGAGAAAGAAGGAAGG + Intronic
941573530 2:167201267-167201289 AGGGAGAAAGGAAAGAAGGAAGG + Intronic
941749132 2:169117140-169117162 GAGGAAAAGATAAAGAAAGAAGG - Intergenic
941788603 2:169525587-169525609 ATGAAGATGATAAAAAAGAATGG + Exonic
941940228 2:171028875-171028897 ATGAAGAAGGCAAAAAAGGATGG + Intronic
942183338 2:173401720-173401742 AAGAAGAAGGGAAAGAAGGAAGG - Intergenic
942200147 2:173562235-173562257 ATGGAGAGCAAAAAGAAGCAGGG + Intergenic
942238451 2:173935972-173935994 AGGGAGAAAGTAAGGAAGGAAGG - Intronic
942582195 2:177430645-177430667 ATGGAGAACAAAGAAAAGGAGGG - Intronic
942721923 2:178962909-178962931 ACGGTAAAGATAACGAAGGAGGG - Intronic
942901356 2:181123636-181123658 CTGGATAATATAAAGAAAGAAGG + Intergenic
942999351 2:182305130-182305152 TTGGAGAAGAGAGACAAGGAAGG - Intronic
943040150 2:182794864-182794886 ATGGATAAGAAAATGAAGTAAGG + Intergenic
943330749 2:186556248-186556270 AAGGAGAAAAGAAAGAAGGAAGG - Intergenic
943400366 2:187401982-187402004 AGGAAGAAGGGAAAGAAGGAAGG + Intronic
943437216 2:187881104-187881126 ATGAGGAAGAGAAAGAAGGGGGG + Intergenic
943575936 2:189631096-189631118 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
943641809 2:190367930-190367952 GTGGGGAAGAAAAAAAAGGAAGG - Intronic
943662554 2:190574832-190574854 AAAGAAAAGAAAAAGAAGGAAGG - Intergenic
943804327 2:192103524-192103546 AAGAACAAGATAAAGTAGGAAGG - Intronic
943821649 2:192330537-192330559 AGGAAGGAAATAAAGAAGGAAGG + Intergenic
943903329 2:193469347-193469369 ATTAGGCAGATAAAGAAGGAGGG + Intergenic
943916781 2:193644910-193644932 ATGGAAAACAAAAAGAGGGATGG + Intergenic
944079243 2:195767860-195767882 ATAAAGAAGATAAAGAAACATGG + Intronic
944153291 2:196585072-196585094 ATGGCAAAGACAAACAAGGAAGG - Intronic
944276393 2:197843298-197843320 ATGAAGAATGTAAAGCAGGAGGG - Intronic
944368511 2:198953859-198953881 ATGGAGAGGGTAAAGGAAGATGG - Intergenic
944427881 2:199602656-199602678 AGGGAAGAGAGAAAGAAGGAAGG + Intergenic
944471509 2:200057932-200057954 ATGGAAAAGAGAAAAAAGTAGGG + Intergenic
944678482 2:202054294-202054316 AGGGAAAAGAGAAAGAAGGAAGG + Intergenic
944867334 2:203875559-203875581 ATGGAGATGATGATGAAGGTTGG - Intergenic
944911078 2:204310901-204310923 ATGAAGAAGATAAACAAAGTGGG + Intergenic
945000787 2:205347928-205347950 CTGGGGAAGATAAAAAAGGGAGG + Intronic
945004441 2:205388966-205388988 AAGGAGAAGCTAAGGAAAGAGGG + Intronic
945028674 2:205643337-205643359 AGGGAGACAATAAAGAAGGAGGG + Intergenic
945053199 2:205845003-205845025 AAGCAGAAGAAAAAGAAAGAAGG + Intergenic
945116556 2:206413881-206413903 ATGGAGAACAAAAAAAAGCAGGG - Intergenic
945155842 2:206836293-206836315 GTGCAGAAGGGAAAGAAGGAAGG + Intergenic
945524207 2:210867949-210867971 ATGGAAAAGAGAAAAAAGCAGGG + Intergenic
946103518 2:217349356-217349378 ATGGAAAACATAAAAAAGCAGGG - Intronic
946220881 2:218225718-218225740 AAGTAGAGGATAAAAAAGGAAGG - Intronic
946410352 2:219512506-219512528 AAGGAGAAGAGAGAGAAGGATGG + Intergenic
946449133 2:219764630-219764652 GTGGAGAAGAGAAGGAAGTAAGG - Intergenic
946559477 2:220896667-220896689 ATGCAGCAGACATAGAAGGATGG + Intergenic
946610996 2:221457799-221457821 AAGAAGAAAACAAAGAAGGAAGG + Intronic
946812451 2:223540267-223540289 AAAGAGAAAAGAAAGAAGGAAGG + Intergenic
946962490 2:224999514-224999536 ATAGAGAAAATAAGGAAAGAGGG - Intronic
947224057 2:227823041-227823063 ATGGAGAAGTGGAAGATGGAAGG + Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947689992 2:232126540-232126562 ATTGAGAAGAGAGAGAAGGCTGG + Intronic
947946247 2:234105383-234105405 CTGGAGAAGGTAAAGGAGGCAGG + Intergenic
947991741 2:234493742-234493764 GTGAAGAAAATAAAGAAAGATGG + Exonic
948317440 2:237039259-237039281 ACGAAGTTGATAAAGAAGGAAGG - Intergenic
948488304 2:238295259-238295281 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
948489475 2:238303237-238303259 ATGGAGACGACAAAGAAGAATGG - Intergenic
948565515 2:238883945-238883967 ATGCAGAGGAGAAGGAAGGACGG - Intronic
948787668 2:240361313-240361335 AAAGAGAAGAGAGAGAAGGAGGG + Intergenic
1168755194 20:311693-311715 ATGGAGTAGAAAAAGAACGTTGG - Intergenic
1169001627 20:2171994-2172016 AGAGAGAAGAGAAAGAAGGAAGG + Intronic
1169021384 20:2333772-2333794 ATGGAAAAGAGAGAGAAGGCAGG + Intronic
1169040469 20:2490324-2490346 AGAGAAAAGAAAAAGAAGGAAGG + Intronic
1169249165 20:4046870-4046892 CTAGAGAAGACAATGAAGGATGG + Intergenic
1169585984 20:7086048-7086070 ATGGAGGAGGAAAAGAAGGAAGG - Intergenic
1169590554 20:7136450-7136472 AGAGAAAAAATAAAGAAGGAAGG + Intergenic
1169686588 20:8280754-8280776 AAGGAAAATATAAAGGAGGATGG + Intronic
1169750726 20:8990622-8990644 AAGGAAAAGAGAAGGAAGGAAGG + Intergenic
1169869107 20:10232415-10232437 TTGGAGAAAATAAGGAAAGATGG - Intronic
1169894789 20:10491414-10491436 ATGGAGAAGACAAAGGAGCAAGG - Intronic
1170021735 20:11844253-11844275 AAGGAAAAAAGAAAGAAGGAAGG + Intergenic
1170075013 20:12409929-12409951 ATACAGAAGAGAAAGCAGGAAGG - Intergenic
1170341846 20:15337790-15337812 TTGTAGAACATATAGAAGGAAGG + Intronic
1170371800 20:15657032-15657054 AAGGAAAGGAGAAAGAAGGAAGG + Intronic
1170378459 20:15729711-15729733 ATGGAAAACAGAAAAAAGGAGGG - Intronic
1170501824 20:16982470-16982492 AGGGAGTAGGGAAAGAAGGAGGG - Intergenic
1170623368 20:18012110-18012132 ATGAAGAAGAGGAAGAAGGTGGG + Intronic
1170813937 20:19697021-19697043 AGGGAGAAGAGAAGGAAAGAGGG + Intronic
1170880907 20:20296018-20296040 AGGAAGAAAAGAAAGAAGGAAGG - Intronic
1170881002 20:20296347-20296369 ATGAAGAAAGGAAAGAAGGAAGG - Intronic
1170902166 20:20474717-20474739 ATGGAGAAGACTGAGAGGGAGGG + Intronic
1171178743 20:23075575-23075597 ATGGAAAAGAAAAAGAAGGCCGG + Intergenic
1171263876 20:23754758-23754780 AGGGAGAAAAGAAGGAAGGATGG - Intergenic
1171993721 20:31716330-31716352 ATGAAGAAAATAAAGCAGGTTGG - Intronic
1172325272 20:34029581-34029603 ATGGGGAAGAGAGAGAAAGAGGG + Intronic
1172898321 20:38316191-38316213 GAGGGGAAGAGAAAGAAGGAAGG - Intronic
1172937421 20:38630182-38630204 AGGAAGAAGAAAAGGAAGGAAGG - Intronic
1172945831 20:38688534-38688556 ATGGAGATGACATACAAGGAGGG - Intergenic
1172974464 20:38895793-38895815 AGGGAGGAGAGAAAGAAGGAAGG - Intronic
1172974470 20:38895820-38895842 AGGGAGGAGAGAAAGAAGGAAGG - Intronic
1172974515 20:38895982-38896004 AGGGAGGAGAGAAAGAAGGAAGG - Intronic
1173133269 20:40414590-40414612 AGGGAGAAGCCAAAGAAGGGAGG + Intergenic
1173426885 20:42951097-42951119 ATGGATGAGAGAATGAAGGATGG + Intronic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173754312 20:45501583-45501605 AGGAAGGAGAGAAAGAAGGATGG - Intergenic
1173861914 20:46289311-46289333 ATGGAGAAGGTGAAGAAAGCAGG - Intronic
1173996115 20:47339835-47339857 ATGGGGATGATAAAGATAGAAGG - Intronic
1174707035 20:52667609-52667631 ATGCAGAAAGGAAAGAAGGAAGG - Intergenic
1174709531 20:52690281-52690303 AAGGAGAAGAAAAAGGAGAAGGG - Intergenic
1174718171 20:52782901-52782923 TGGGACAAGATGAAGAAGGATGG - Intergenic
1174730769 20:52914863-52914885 AAGGAGAAGAGAATGAAGCAGGG - Intergenic
1174755127 20:53150716-53150738 GAGGAAAAGAAAAAGAAGGAGGG + Intronic
1174849704 20:53980809-53980831 ATAGAGAACATACAGAAAGAAGG - Intronic
1174921232 20:54704680-54704702 AGAAAGAAAATAAAGAAGGAAGG - Intergenic
1176657310 21:9598776-9598798 ATGGAGTAGAGAAAGAGGGAAGG + Intergenic
1176890014 21:14304100-14304122 ATCGTGAAGATAAAAAATGATGG - Intergenic
1176984827 21:15423704-15423726 ATTGAGAAGATAGAAAATGAAGG + Intergenic
1177118874 21:17118050-17118072 AGGGAGAAGATGATGCAGGAAGG - Intergenic
1177506157 21:22020115-22020137 AAAGAGAAAAAAAAGAAGGAGGG + Intergenic
1177537860 21:22451843-22451865 AGGGAGGAAAAAAAGAAGGAAGG - Intergenic
1177729269 21:25007275-25007297 AAGGAGAAAGTAAAGAAGAAGGG + Intergenic
1177744589 21:25196072-25196094 AGGGAGAAAAGAAAGAAGAAAGG - Intergenic
1178061571 21:28858679-28858701 ATGGAGAAAATAAAGAGGCAAGG - Intergenic
1178191511 21:30287483-30287505 AAAGAAAAAATAAAGAAGGAAGG + Intergenic
1178548963 21:33519061-33519083 ATGGAAAAGAAACAGAAAGAAGG - Intronic
1178788235 21:35674096-35674118 AGGGAGAAGATAATGAAAAAAGG + Intronic
1178889515 21:36509476-36509498 ATGGAGAAGATACATATGGTTGG + Intronic
1178979236 21:37247730-37247752 TTGGAGAGGATAAAAAAGAAAGG + Intronic
1179163461 21:38916802-38916824 AGGAAGAAGAGAAGGAAGGAGGG + Intergenic
1179163468 21:38916839-38916861 AGGAAGAAGAGAAGGAAGGAGGG + Intergenic
1179163478 21:38916884-38916906 AGGAAGAAGAGAAGGAAGGAGGG + Intergenic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179302309 21:40123742-40123764 ATGGAGGAGGGAAAGAAGGGAGG + Intronic
1179470100 21:41604751-41604773 GAGGAGACGAGAAAGAAGGAAGG - Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180105952 21:45618176-45618198 TGGGAGAAGTTACAGAAGGAAGG - Intergenic
1180595911 22:16973207-16973229 GTGGAGAAGATAAATAACAATGG - Intronic
1180607076 22:17066971-17066993 AGGAAGGAGAGAAAGAAGGAAGG + Intergenic
1180640773 22:17297435-17297457 ATGGAAAACATAAAAAAGCAGGG - Intergenic
1181018707 22:20086826-20086848 GTGGAGAAGAGAAAGATGTAAGG + Intronic
1181403099 22:22663657-22663679 ATGGGGAAAATCAAGAAAGAAGG + Intergenic
1181716985 22:24738158-24738180 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1181836539 22:25614895-25614917 ATGGAGAAGACTAAGACAGAAGG + Intronic
1181856993 22:25789038-25789060 AAAGAGAAGAAAAAGAAAGAAGG - Intronic
1181898218 22:26129859-26129881 GTCAAGAAGACAAAGAAGGAAGG - Intergenic
1181982468 22:26775073-26775095 ATGGAGAAGACAAGGCAAGATGG - Intergenic
1182298101 22:29321888-29321910 ATAGAGTACATAAAGGAGGATGG + Intergenic
1182320513 22:29475925-29475947 AGGGAGAGGAGAAAAAAGGAGGG + Intergenic
1182353595 22:29712254-29712276 AAAGAGAAGGGAAAGAAGGAAGG + Intergenic
1182466783 22:30521859-30521881 AAGGAAAAGAAAAAGAAGGAAGG - Intergenic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182550563 22:31098809-31098831 ATTGAGAAGCTGGAGAAGGAGGG + Exonic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1182960592 22:34470883-34470905 AAGGATAAGAATAAGAAGGAGGG - Intergenic
1183020905 22:35024942-35024964 AAAGAGAAGACAAAGCAGGAAGG + Intergenic
1183596637 22:38816640-38816662 ATTGAGAAGATAAAGTGGAAGGG + Intergenic
1183628088 22:39016924-39016946 ATCAATAAAATAAAGAAGGAAGG + Intronic
1183698813 22:39438208-39438230 AGGGAGAAGGGAAGGAAGGAGGG - Intergenic
1183951001 22:41353184-41353206 ATGGCGAAGATCAGGAGGGATGG - Intronic
1184165900 22:42727583-42727605 ATGAAGAAGACAGGGAAGGAAGG - Intergenic
1184441053 22:44515943-44515965 AGGCAGAAGAAAAAGAAGTAGGG - Intergenic
1184449471 22:44574513-44574535 AAGGAGGAGAAAGAGAAGGAGGG + Intergenic
1184480909 22:44746341-44746363 ATGGAGAATTTCAAGGAGGAGGG - Intronic
1184815789 22:46868751-46868773 AAGGAGAAGAGGAAGAAGCATGG - Intronic
1184950648 22:47840374-47840396 ATGGAGAAGAAAAGGAAGTCAGG - Intergenic
1185037057 22:48484878-48484900 AAGGAGAAGGAAGAGAAGGAGGG - Intergenic
949155931 3:827267-827289 ATGGAGAGGAAAAAGTGGGAAGG + Intergenic
949441727 3:4088532-4088554 ATAGACAAAATAAAGGAGGAAGG - Intronic
949511051 3:4767447-4767469 AAAGAGAAGAAAAAGAAGAATGG + Intronic
949582164 3:5399351-5399373 AGGGAGTAGATCAAGAAAGACGG - Intergenic
949878168 3:8640643-8640665 AAGGAGAACAGAAAGAAAGAAGG + Intronic
949952155 3:9238224-9238246 ATGGAGGAGATGGAGAAGGAAGG + Intronic
950014124 3:9744201-9744223 CTGGAGCAGAGAAAGAAAGAAGG - Intronic
950299660 3:11865803-11865825 ATGGAAAACAAAAAGAAGGAGGG - Intergenic
950360811 3:12448305-12448327 AAGGAGAAGGGAAGGAAGGAAGG + Intergenic
950978200 3:17273232-17273254 ATGGAGAAGATTCAGAATGTGGG - Intronic
951417662 3:22444934-22444956 ATGAAGGAGAGAAGGAAGGAGGG + Intergenic
951499077 3:23363467-23363489 ATGGAAAACAGAAAAAAGGAGGG + Intronic
951516331 3:23563995-23564017 AAAGAAAAGAGAAAGAAGGAAGG + Intronic
951595721 3:24316371-24316393 AGGGAAAAGAGAAAAAAGGAAGG - Intronic
951599940 3:24362493-24362515 ATGGAGAGAAAAAAGAAGAAGGG - Intronic
951729598 3:25796061-25796083 AAGGAGAAGATAAAGAAGGAAGG + Intergenic
951730063 3:25800328-25800350 ATAGGGAAGATTAAGAAGCAAGG - Intergenic
951841209 3:27036108-27036130 AAAGAAAAGAAAAAGAAGGAAGG + Intergenic
952142679 3:30497603-30497625 ATGGAAATGAGAAAGAAGGGTGG + Intergenic
952513793 3:34083534-34083556 ATGGAAAACAAAAAGAAGCAGGG - Intergenic
952515160 3:34096379-34096401 ATGGAAAACAAAAAGAAGCAGGG + Intergenic
952539719 3:34355118-34355140 ATGAAGGAGATAAAAAAGGCAGG - Intergenic
952708289 3:36402287-36402309 ATGGAGGGGAAGAAGAAGGAAGG + Intronic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
953149709 3:40313744-40313766 ATGAAGAAGATCAAGAAGTTTGG + Intergenic
953183358 3:40616511-40616533 GGGGAGCAGATAAAGGAGGACGG + Intergenic
953787720 3:45923215-45923237 AGGGAGAAATAAAAGAAGGAAGG - Intronic
954488645 3:50879447-50879469 ATGGAAAACAAAAAAAAGGAAGG + Intronic
954859876 3:53678706-53678728 ATGGAGAATGTGAAGAGGGAAGG + Intronic
954892007 3:53939325-53939347 ATGCCGGAGATAACGAAGGAGGG + Intergenic
954910039 3:54096973-54096995 AGAAAGAAGAGAAAGAAGGAAGG - Intergenic
955103518 3:55874706-55874728 ATGGAGAAGCTACAGAAGTAGGG + Intronic
955731873 3:61995763-61995785 AAGAAAAAGAAAAAGAAGGAGGG - Intronic
955951314 3:64245266-64245288 ATGGGTCAGATAAGGAAGGACGG + Intronic
955988415 3:64599412-64599434 ATGGACAAAATAAAGGAGAATGG + Intronic
956154469 3:66281059-66281081 ATGGAGGAAATAAAAAAGGTTGG - Intronic
956547776 3:70424958-70424980 GAGGAGGAGAAAAAGAAGGAGGG + Intergenic
956576725 3:70760322-70760344 ATGGAGGTGATAAAGGTGGACGG + Intergenic
956594320 3:70949468-70949490 ATGGAAACAATAAAGAAGGCCGG + Intergenic
956695087 3:71911902-71911924 ATGGTGAAAAGAAATAAGGATGG + Intergenic
956768155 3:72501967-72501989 ATGGACAAGAAAAAGCAGGCTGG + Intergenic
957416903 3:79917295-79917317 ATGGACTAGATAAAAAAGGGTGG + Intergenic
957467897 3:80619312-80619334 ATAGACAATAAAAAGAAGGAAGG + Intergenic
957748288 3:84374635-84374657 ATGAAGAAGATAATAAAAGAAGG + Intergenic
957784087 3:84858234-84858256 ATGCAGAAGATAAAAATGTAAGG + Intergenic
957791747 3:84950562-84950584 AAAGAGAAAAGAAAGAAGGAAGG + Intergenic
957862087 3:85966446-85966468 AAGGAGAAAATAATGAAGTAAGG - Intronic
957900485 3:86482532-86482554 ATGAAGAAGAGAAAGCATGAAGG - Intergenic
957911854 3:86629198-86629220 TTTAAGAAGAAAAAGAAGGAAGG - Intergenic
957977313 3:87463148-87463170 AAGGAAAAAAGAAAGAAGGAGGG + Intergenic
958087236 3:88825975-88825997 AAGGAGAAAGGAAAGAAGGAAGG - Intergenic
958111983 3:89159940-89159962 AGGAAGAAGGAAAAGAAGGAAGG - Intronic
958122047 3:89303462-89303484 AGGAAGAAAATAAAGGAGGAAGG + Intronic
958144965 3:89612428-89612450 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
958144990 3:89612538-89612560 AAGGAGAAAAAAAGGAAGGAAGG - Intergenic
958423578 3:93955546-93955568 ATGGAGAACATAACACAGGACGG + Intronic
958828012 3:99055580-99055602 AGGAAGAAAAGAAAGAAGGAAGG - Intergenic
958845009 3:99255785-99255807 ATGCAGTAGGGAAAGAAGGAAGG - Intergenic
959082596 3:101817690-101817712 ATGGATGAGGTAAGGAAGGAGGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959317798 3:104831080-104831102 ATGAACAAGATGAAGAAGGAAGG + Intergenic
959351488 3:105270311-105270333 ATTGAGAAGATCAAGAAGACTGG - Intergenic
959411303 3:106025951-106025973 ATGAAAAAGAAAGAGAAGGAAGG + Intergenic
959460551 3:106620748-106620770 ATAGAGAAGAAAGAGAAGGAAGG + Intergenic
959502754 3:107125267-107125289 AAGGAGAAGAAAAAAAAGGGGGG + Intergenic
959839299 3:110955868-110955890 TTTCAGAAGATTAAGAAGGATGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960208418 3:114930993-114931015 GTGGAGAAAAGAACGAAGGACGG + Intronic
960246369 3:115404600-115404622 AGGAAGAAAAGAAAGAAGGAGGG + Intergenic
960246784 3:115408522-115408544 ATGGAAAAAAGAAAGAAGGATGG + Intergenic
960427048 3:117521403-117521425 AGGAAGAAAAGAAAGAAGGAAGG - Intergenic
960513836 3:118581079-118581101 GAGGAGAAGAGAGAGAAGGATGG - Intergenic
960740958 3:120832956-120832978 ATGGAAAAGAGAGAGAAGAAAGG - Intergenic
960795960 3:121488089-121488111 ATGGAGGAGATCAAGATGAAAGG - Exonic
960812148 3:121635669-121635691 CTGGGGAAGAAAAAGAATGAGGG + Intronic
960846671 3:122010219-122010241 ACAGAGAAGATAAATAAGGCGGG + Intronic
961070993 3:123926701-123926723 TTGGAGAAGGAAAAGAAAGAGGG + Intronic
961282511 3:125775020-125775042 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
961368309 3:126415080-126415102 TTGGAGAAGATACAGTAGGGTGG - Intronic
961395885 3:126589790-126589812 ATGGAAAACAAAAAGAAGCAGGG - Intronic
961569304 3:127786626-127786648 ATGGAGAGGATAAAGCAGCCTGG - Intronic
962470610 3:135704779-135704801 AGAAAGAAGAAAAAGAAGGAAGG - Intergenic
962490875 3:135893002-135893024 AGGGAGAAAGTAAGGAAGGAAGG + Intergenic
962694067 3:137930291-137930313 AGGAAGAAAAGAAAGAAGGACGG + Intergenic
962722693 3:138190587-138190609 ATGTAGAAGATAAAGAATCTCGG - Intronic
962803443 3:138909826-138909848 ATGGAGAAGAGAGGGGAGGAAGG + Intergenic
962865938 3:139448083-139448105 AGGAAGAAGAGAAAGGAGGAAGG - Intergenic
962878591 3:139554738-139554760 ATAGGGAAGAGAGAGAAGGAGGG + Intergenic
963049325 3:141128034-141128056 GAGGAGAAGAAAAAGAAGGCTGG + Intronic
963249523 3:143090290-143090312 ATGGAAAAGAGAAAGAAAGAGGG - Intergenic
963292556 3:143507051-143507073 ATGCACAAGATGAATAAGGAAGG - Intronic
963325458 3:143857517-143857539 ATAGAGAAGGTAAAGAGGGTGGG - Intergenic
963405397 3:144856681-144856703 AGGGAGAAGGGAAGGAAGGAAGG - Intergenic
963431286 3:145207685-145207707 ATGAAAAAGAAAAAGAAGGAGGG + Intergenic
964040191 3:152252219-152252241 AGGGAGAAAAGAAGGAAGGAAGG - Intronic
964557174 3:157952469-157952491 AGGAAGAAGAGAAAGAAGGAAGG - Intergenic
964564316 3:158033112-158033134 AAGAAGAAGAAAAAGAAGGGTGG + Intergenic
965053504 3:163683124-163683146 ATGGTGAAGAGAGAGAGGGAAGG - Intergenic
965213772 3:165831734-165831756 ATGGAAAAAATAAAGAGCGAAGG + Intronic
965270477 3:166611656-166611678 AAAGAGTAGATAAAGAAGAAAGG - Intergenic
965594873 3:170400692-170400714 AGGAAGAAGAAAGAGAAGGAAGG - Intergenic
965725313 3:171709968-171709990 ATGAGGAGGATAAAGAAAGAGGG + Intronic
965757710 3:172041441-172041463 GAGGAGAAGAGAAGGAAGGAAGG - Intronic
965817111 3:172648125-172648147 AGGGAGGAAATAAAGAGGGAGGG + Intronic
965847414 3:172980320-172980342 AAGGAGAATAGAAAGAATGATGG - Intronic
965888287 3:173476960-173476982 CTGATTAAGATAAAGAAGGAAGG + Intronic
966142188 3:176769074-176769096 AGGAAGAAAAGAAAGAAGGAAGG + Intergenic
966336769 3:178876759-178876781 AGGAAGGAGAAAAAGAAGGAAGG + Intergenic
966354218 3:179061992-179062014 ATGGAGAGGAAAAAAAAGGTAGG + Intronic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966598035 3:181745028-181745050 AAGGGGAAGAGAGAGAAGGAAGG - Intergenic
966939070 3:184734006-184734028 AGGGAGAAGAGAAAGAATAAGGG - Intergenic
967143826 3:186588736-186588758 GTGGACAAGATAAAGAAATATGG - Intronic
967344058 3:188433761-188433783 AGAGAGAAGGAAAAGAAGGAAGG + Intronic
967502850 3:190220436-190220458 ATGGAAAACAGAAAGAAGCAGGG - Intergenic
967553372 3:190825867-190825889 AAGGAAAAGAGAAGGAAGGAAGG - Intergenic
967574081 3:191069786-191069808 CTGAAGAAGAAAAAGAAGAATGG + Intergenic
967584798 3:191199067-191199089 AGGGAGAAACTGAAGAAGGAAGG + Intergenic
967893562 3:194380285-194380307 AGGCAGAAGGGAAAGAAGGAAGG + Intergenic
967932690 3:194701945-194701967 AAGAAGAAGAAAAAGAAGAAAGG - Intergenic
968165775 3:196464070-196464092 GTGGAGAAGAGCCAGAAGGAAGG + Intergenic
969015216 4:4099377-4099399 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
969253105 4:5982866-5982888 ATGAAGAAGGTGAAGAATGAGGG + Intronic
969738718 4:9008874-9008896 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
969797922 4:9540519-9540541 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
969915566 4:10487874-10487896 AGGGAGAAGAAACAGAAGTATGG - Exonic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
970204301 4:13640708-13640730 AAGGAGAAGATAGGGAAAGAGGG + Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970310990 4:14782343-14782365 ATAGATAAGATAGATAAGGATGG + Intergenic
970743360 4:19264729-19264751 ATGAAAAAAAGAAAGAAGGAAGG - Intergenic
970782398 4:19753952-19753974 ATGGAGAAGAGAAACAGTGAAGG - Intergenic
970810781 4:20091621-20091643 GGGGAGAAAAGAAAGAAGGAAGG + Intergenic
971178030 4:24300125-24300147 CTGGAGTAGATAACGAAGGCAGG - Intergenic
971199096 4:24495666-24495688 AAGGAGAATAGAAGGAAGGAAGG + Intergenic
971303382 4:25460480-25460502 ATGTAGAAAATGAAAAAGGAGGG - Intergenic
971408479 4:26344680-26344702 AAGCAGAAGAGAAAAAAGGAAGG + Intronic
971563071 4:28106178-28106200 ACGAAGAAAGTAAAGAAGGAAGG + Intergenic
971632882 4:29017630-29017652 ATGGAGAAAATATAAATGGAAGG - Intergenic
971632887 4:29017704-29017726 ATGGAGAAAATACAAATGGAAGG - Intergenic
971665511 4:29478587-29478609 ATGGGAAAGAAAAGGAAGGAAGG + Intergenic
972333726 4:38086886-38086908 ATGTAGAAGTTAGAGAAGCACGG + Intronic
972539136 4:40023944-40023966 GTGAAGAAGATGAAGTAGGAAGG + Intergenic
972685387 4:41347818-41347840 GTGAAGAAGAGAAGGAAGGAAGG - Intergenic
972827065 4:42771220-42771242 TTCCAGAAGATAAAGAAAGAGGG + Intergenic
972894088 4:43597543-43597565 AGGAAGAAAATAAAGAAGGGTGG - Intergenic
972954305 4:44370006-44370028 ATGAAGAAAATAAAGCTGGATGG + Intronic
973019642 4:45186675-45186697 AGGAAGAAAATAAGGAAGGAAGG - Intergenic
973085047 4:46048361-46048383 ATGGAATAGAGAAGGAAGGAAGG + Intronic
973087394 4:46082711-46082733 GTAAAGAGGATAAAGAAGGAGGG - Intronic
973090157 4:46125408-46125430 TGGGAGAAGAAAAACAAGGAGGG - Intergenic
973628448 4:52795507-52795529 AGGAAGAAGAAGAAGAAGGAAGG + Intergenic
973751797 4:54027625-54027647 ATGGGGAAGATAGTGAAGAAGGG + Intronic
974118095 4:57605681-57605703 AGAAAGAAAATAAAGAAGGAAGG - Intergenic
974183341 4:58412140-58412162 AGGGAGAAGAAAGAGAAGAAGGG - Intergenic
975028215 4:69578513-69578535 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
975259551 4:72280712-72280734 ATGAAGAAGATGAGGAAAGATGG - Intergenic
975504463 4:75122940-75122962 AGGAAGAAGAAAAGGAAGGAAGG + Intergenic
975952943 4:79796419-79796441 AAGAAGAAAAGAAAGAAGGAGGG - Intergenic
976017020 4:80568692-80568714 ATGGAGAGGAGAAAGAAGAAAGG + Intronic
976153836 4:82121174-82121196 ACCGAGAAGAAAAAGAAAGAGGG + Intergenic
976402038 4:84618448-84618470 GAAGAGAAGATAAATAAGGATGG + Intronic
976479332 4:85521441-85521463 ATGGAGGTGATAAAAAGGGAGGG - Intronic
976615273 4:87069631-87069653 AAGGAGAAGAGAAAAAAGGAAGG - Intronic
976667547 4:87612968-87612990 ATGATGAAGATGAAGAAGCAGGG + Exonic
976841818 4:89440899-89440921 AAGAAGAAAATAAAGAAAGAAGG - Intergenic
976842744 4:89451001-89451023 TTGCATAAGATGAAGAAGGAAGG + Intergenic
977149971 4:93499127-93499149 ATGGAGAAGAAATAGAAGCGGGG - Intronic
977218129 4:94307509-94307531 ATGGAGTAAACAAAGAAAGAAGG + Intronic
977327689 4:95597065-95597087 ACAGAGAAAAGAAAGAAGGAAGG - Intergenic
978295068 4:107195472-107195494 AAGGAGAAAATATGGAAGGATGG + Intronic
978499960 4:109399071-109399093 GAGGAGAAGAGAAAGAGGGAGGG + Intergenic
979086707 4:116421110-116421132 AAGAAGAAAAGAAAGAAGGAAGG - Intergenic
979324775 4:119366109-119366131 ATTCAGAATATAAAGAGGGAAGG - Intergenic
979411831 4:120388742-120388764 ATGGAAAAAATAAAGAAATAGGG - Intergenic
979673971 4:123390775-123390797 ATGGAGAAGATAAAGTAGTGGGG - Intergenic
979744769 4:124198226-124198248 ATGGACAAGAGAATGAATGAAGG + Intergenic
979789271 4:124757766-124757788 ATGGAAAAGATGAAGAAGTTGGG - Intergenic
979849572 4:125559619-125559641 AGGGAGGAGAGAAGGAAGGAAGG - Intergenic
979955763 4:126952053-126952075 AGGGAGGAAAGAAAGAAGGAAGG + Intergenic
980086526 4:128396361-128396383 TTGGACAAGATGAATAAGGAAGG - Intergenic
980121189 4:128730224-128730246 AAGGGGAAGAGAAGGAAGGAGGG - Intergenic
980203597 4:129688540-129688562 ATGTAGGTGATAAAGATGGAGGG - Intergenic
980344577 4:131596362-131596384 AGGAAGAATATAAGGAAGGAAGG - Intergenic
980425640 4:132624470-132624492 ATAGAGAAGAAGGAGAAGGAAGG - Intergenic
980512161 4:133807827-133807849 TTTGAAAAGATGAAGAAGGATGG + Intergenic
980512731 4:133814395-133814417 ATGGAAAACAGAAAAAAGGAGGG + Intergenic
980807098 4:137828178-137828200 AAGGGGAAGAAAAGGAAGGAAGG + Intergenic
980807110 4:137828216-137828238 AAGGGGAAGAAAAGGAAGGAAGG + Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
980838271 4:138224785-138224807 AGGAAGAAGGAAAAGAAGGAAGG + Intronic
980991860 4:139745126-139745148 AGTGAGAAGAGAAGGAAGGAAGG + Intronic
981254379 4:142644235-142644257 AAGGAGGAGAAAGAGAAGGAAGG + Intronic
981289699 4:143060087-143060109 ATGGTGAAGACACAAAAGGAGGG - Intergenic
981369922 4:143948267-143948289 AGAGAGAAGAAGAAGAAGGAAGG - Intergenic
981409261 4:144409802-144409824 AAGAAGAAGAGAGAGAAGGAAGG + Intergenic
981511463 4:145563050-145563072 ATTTACAAGATAGAGAAGGATGG + Intergenic
981522239 4:145675299-145675321 ATGATGAAGATAAAGAATGAAGG - Intergenic
981892194 4:149751859-149751881 ACAGAGAACACAAAGAAGGATGG + Intergenic
981945886 4:150343550-150343572 ATTGAGTAGATAAGAAAGGAAGG - Intronic
982232419 4:153221753-153221775 AGGGAGGAAATAAGGAAGGAAGG + Intronic
982397563 4:154928506-154928528 ATGGAGAAGGAAATGAGGGAAGG + Intergenic
982404141 4:155001912-155001934 AGGGACAAGATAAAGACAGAGGG - Intergenic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
982782410 4:159505103-159505125 TTGGAGAAGGGAAAGAAGGGAGG - Intergenic
982787741 4:159556146-159556168 ATGGAGGAAGGAAAGAAGGAAGG - Intergenic
982787749 4:159556182-159556204 ATGAAGGAGGGAAAGAAGGAAGG - Intergenic
982793501 4:159619036-159619058 ATGGAGAAGATTTATTAGGAAGG + Intergenic
982959169 4:161814102-161814124 AAGGGGAAGAGAAAGATGGAAGG + Intronic
983089830 4:163490109-163490131 AAAGAGAAGAAAAGGAAGGAAGG - Intergenic
983242621 4:165250808-165250830 ATTCAGAATATAAAGAGGGAAGG - Intronic
983483554 4:168305840-168305862 ATGGAGAAGGTCAATAAAGAAGG - Intronic
983484408 4:168317416-168317438 ATGGAAAAGAGAAAAAAGGAGGG + Intronic
984008456 4:174342306-174342328 ATAGAAAAAATAAGGAAGGACGG + Intergenic
984042516 4:174752951-174752973 ATGGAGAACATGAAGAAACATGG - Intronic
984070301 4:175103245-175103267 AGGGAGAAGAAAGAGAAAGAAGG + Intergenic
984177048 4:176432080-176432102 ATAGGGATGATAAAGAAAGAAGG - Intergenic
984233144 4:177124245-177124267 ATGGAGAGGAAAGAGAGGGAGGG - Intergenic
984416791 4:179470998-179471020 ATGGTGAACATAAAGCTGGAAGG + Intergenic
984546574 4:181111617-181111639 ATGGAGAAGAAAACAAATGACGG - Intergenic
984688488 4:182698376-182698398 GTGAAGGAGATAAGGAAGGAGGG - Intronic
984762857 4:183377389-183377411 AATGAGAAAAGAAAGAAGGAAGG - Intergenic
985147788 4:186912061-186912083 TTGCAGAAGAGAAAAAAGGAAGG - Intergenic
985312441 4:188616991-188617013 ATGAAGAAGATTAAGATGGAAGG + Intergenic
985418114 4:189757353-189757375 ATGGAATAGAGAAAGAGGGAAGG - Intergenic
985703757 5:1388872-1388894 ATGGACAAAAGAAAGAAGAAAGG - Intergenic
985851570 5:2392418-2392440 AGGGAGGAGAGAAAGAAGGAAGG - Intergenic
986001147 5:3631795-3631817 AAGGAGAAGGGAAGGAAGGAAGG - Intergenic
986243779 5:5985992-5986014 ATTGAGATGAAAAAGAAGGTAGG + Intergenic
986294393 5:6424897-6424919 AGGAAGAAGAGAAAGAAAGAAGG - Intergenic
986313592 5:6571758-6571780 AGGGAGGAGAGAAGGAAGGAAGG + Intergenic
986403632 5:7404291-7404313 ATGGATAAGATAAACAAAGAGGG - Intronic
986468366 5:8049962-8049984 AAGGAGAAGGGAAGGAAGGAAGG + Intergenic
986468443 5:8050296-8050318 AAGGAGAAGGGAAGGAAGGAGGG + Intergenic
986468481 5:8050481-8050503 AAGAAGAAAAGAAAGAAGGAAGG + Intergenic
986775074 5:11006778-11006800 AGGCAGAAGATGGAGAAGGATGG + Intronic
986796534 5:11218066-11218088 ATGAAGAGGAAAAGGAAGGAAGG - Intronic
986811303 5:11362245-11362267 ATGGAGATTACAAAGAAGTAAGG - Intronic
986857881 5:11892290-11892312 ATCGAGAAGACAAATAAGGTAGG - Intronic
986994058 5:13586043-13586065 ATGGGGTAGATAAAGGATGATGG + Intergenic
987030739 5:13974610-13974632 ATGAAGGACATAGAGAAGGATGG - Intergenic
987143098 5:14965356-14965378 AAGGAGAGGAGAAAGAAGGTGGG - Intergenic
987563090 5:19549602-19549624 AAGAAGAAAATAAAGAAAGAAGG + Intronic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
988007860 5:25441838-25441860 ACAGAGAAAATAAAGAAGCATGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988143461 5:27273144-27273166 ATGTAGAAGACAACGAAGCAAGG - Intergenic
988346712 5:30046288-30046310 ATGGAGAGGAGAGGGAAGGAAGG + Intergenic
988418303 5:30974314-30974336 ATGGTGCAGATATAGAAGAAAGG - Intergenic
988617345 5:32787785-32787807 ATGGAGAAGATAGACAGTGAGGG + Exonic
988628747 5:32906323-32906345 ATTTTGAAGATAAAGATGGAAGG + Intergenic
988653841 5:33184830-33184852 ATGAAAAAGAGAAAGCAGGAAGG - Intergenic
989119166 5:37986383-37986405 AGGGAGCAGAGATAGAAGGAAGG - Intergenic
989214363 5:38888599-38888621 ATGGAGAAAGAAAAGAGGGAAGG - Intronic
989377675 5:40781809-40781831 ATGTATAAGAGAAAGAAGGAAGG + Intronic
989535311 5:42556896-42556918 ATGGAGGAGTGAAAGAAGAAGGG - Intronic
989566058 5:42902605-42902627 AAAGAAAAGAAAAAGAAGGAAGG + Intergenic
990125027 5:52505040-52505062 ATGAGGAAGGGAAAGAAGGAAGG + Intergenic
990408358 5:55514820-55514842 AAAGATAAGATGAAGAAGGAAGG + Intronic
990465989 5:56071899-56071921 AAGAAGAAAAGAAAGAAGGAAGG + Intergenic
990537992 5:56742731-56742753 AAGGAGAAGAAGAAGAAGGGGGG - Intergenic
990793779 5:59516314-59516336 AAGGAAAAGCTAAAGAAAGAGGG - Intronic
990846164 5:60142171-60142193 ATGGACAATACATAGAAGGAAGG + Intronic
990985089 5:61634049-61634071 ATGGAGAAAATAGAGATGGATGG - Intergenic
991035403 5:62123074-62123096 GTGGAGAAGATCAGGATGGAGGG + Intergenic
991055531 5:62315633-62315655 ATGAAGAAGATAAGGGAGGAGGG + Intronic
991156177 5:63439101-63439123 ATGGAGAAGAGACAAAGGGAGGG - Intergenic
991286044 5:64977217-64977239 AAGTAGAAGATGATGAAGGATGG + Exonic
991336611 5:65555267-65555289 ATGAAGAAGATAAAGAAATGAGG + Intronic
991552618 5:67857671-67857693 ATGATGCAGATAAAGCAGGAAGG - Intergenic
991635348 5:68699047-68699069 GTGTAAAAGATAAAGAAGGTAGG + Intergenic
991691926 5:69233806-69233828 AGGGACAAGAAAAAGAAAGAAGG - Intergenic
992629661 5:78667956-78667978 AAGGGGAAGAAAAAGGAGGAGGG - Intronic
992899836 5:81283051-81283073 ATGAAGAATAAAAAGAATGAAGG - Intergenic
992953252 5:81881572-81881594 ATGGAGAAAATGAAGCAGGGAGG + Intergenic
993032265 5:82718331-82718353 AAGGAGAAAAGAAAGAAGGAGGG + Intergenic
993042178 5:82826829-82826851 AGGAAATAGATAAAGAAGGAAGG + Intergenic
993045239 5:82858843-82858865 AGGGAGAAAAGAAAAAAGGAGGG - Intergenic
993174502 5:84466163-84466185 ATGGAGCAGATAAAGGAAGGTGG + Intergenic
993187465 5:84637751-84637773 AGGGAGAAAGGAAAGAAGGAAGG - Intergenic
993199800 5:84800755-84800777 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
993322468 5:86489069-86489091 ATGGAGAGGAGAATGAGGGAGGG + Intergenic
993346923 5:86795719-86795741 AAGGAGAAAACAAAGGAGGAAGG + Intergenic
993681665 5:90885856-90885878 ATGAAGAAGAAAGGGAAGGAGGG + Intronic
994102493 5:95909115-95909137 ATGGAGAAGACAAATAAGGGAGG + Intronic
994450568 5:99936406-99936428 ATGGAGAAGGTAAACCAGGATGG + Intergenic
994572562 5:101532909-101532931 ATGGAGAACAAAAAGAAGAAAGG - Intergenic
994839276 5:104900825-104900847 ATAGGGAAGAAAATGAAGGAAGG - Intergenic
994916789 5:105991113-105991135 TTGGAGAAGATAGAGATGGGAGG - Intergenic
995150343 5:108836803-108836825 AGGAAGAAGATAAAGAAGAGGGG - Intronic
995529382 5:113076975-113076997 ATGGAAAACAAAAAGAAGCAGGG + Intronic
995623610 5:114054503-114054525 AAGGAGAGGATAGGGAAGGAGGG + Intergenic
995645183 5:114303850-114303872 ATAGAGTAGATTCAGAAGGAAGG + Intergenic
995821574 5:116240305-116240327 ATGGAGAAGAGAGAAAAGAATGG + Intronic
996053772 5:118962597-118962619 ATGGAGAAGAAAAAGGAAGTGGG + Intronic
996055113 5:118973953-118973975 ATGAAGAAGAGGAAGAAGGTGGG + Intronic
996215824 5:120864153-120864175 AAGAGGAAGATAAAGAGGGAGGG - Intergenic
996301513 5:121992326-121992348 GGGGAGAAGAGAAAGAAAGAGGG - Intronic
996367776 5:122721206-122721228 ATGGAGAAGGAAAGGAAGGAAGG + Intergenic
996446716 5:123561795-123561817 ATCCAGAAGATCAAGCAGGAAGG - Intronic
996471919 5:123871260-123871282 TTGGAGAAGCTGGAGAAGGAAGG + Intergenic
996491570 5:124104317-124104339 ATGGAGAAAATAAGGAAAGAAGG - Intergenic
996624149 5:125549660-125549682 ATGTAGAAGAGGTAGAAGGAGGG - Intergenic
996787699 5:127258304-127258326 ATGAAGAAAATAAAGAAATAAGG + Intergenic
996891354 5:128424426-128424448 AAGGAGAAGATAGAAAGGGAAGG + Intronic
996898905 5:128520953-128520975 ATGAAAAAAATAAAGATGGATGG + Intronic
996936957 5:128960530-128960552 ATGGAAAACAAAAAAAAGGAGGG - Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997137963 5:131346321-131346343 ATGGAAAACAAAAAAAAGGAGGG + Intronic
997271598 5:132544065-132544087 TTGTTGAAGATAAAGAGGGAAGG + Intronic
997313365 5:132909871-132909893 AAGGGGAAGGTAAAGAGGGAAGG + Intronic
997425286 5:133798935-133798957 AAGGAGAGGATAAGGAAGGGAGG + Intergenic
997662416 5:135599723-135599745 ATGAACAAGAGAAGGAAGGAAGG - Intergenic
998012104 5:138703621-138703643 ATGAACAAGAGAAAGAAAGAAGG - Intronic
998383412 5:141742093-141742115 AGAGAGAAGGGAAAGAAGGAAGG - Intergenic
998385862 5:141756789-141756811 AGGGTGAGGATAAAGTAGGAGGG - Intergenic
998704355 5:144741311-144741333 TAGGAGAAGAAAAGGAAGGATGG - Intergenic
998964349 5:147522941-147522963 ATGGAAAAGAAAAAAAAGAAAGG - Intergenic
999100893 5:149025109-149025131 CTGGAGAAGATCCAGAAGGCAGG - Intronic
999145905 5:149393677-149393699 AGGAAGAAAAAAAAGAAGGAAGG - Intronic
999481236 5:151950008-151950030 GTGGGGATGAGAAAGAAGGAAGG - Intergenic
999592467 5:153163457-153163479 TGGTAGAAGATAAAGAAGGTTGG - Intergenic
999618173 5:153447544-153447566 ACAGAGATGATAAAGAAGAATGG + Intergenic
999664967 5:153903555-153903577 GTGGAGAATATGTAGAAGGAGGG - Intergenic
999751713 5:154632358-154632380 AGGGAGAAGGGAAAGAAGGAAGG - Intergenic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
1000175230 5:158745714-158745736 ATGTAGAGGATAAAGAGGGAGGG + Intronic
1000266343 5:159641574-159641596 AAGGAGAAAAGAAAGAAGGAAGG + Intergenic
1000289513 5:159857414-159857436 CGGGACAAAATAAAGAAGGAGGG + Intergenic
1000489264 5:161889312-161889334 ATGGGGATAATAAAGAAGAATGG - Intronic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1001120723 5:168977857-168977879 ATGGAAAAGGTGAAGAGGGAGGG + Intronic
1001175203 5:169462140-169462162 AGGGAGAAAACAAAGAAAGAGGG + Intergenic
1001196627 5:169678920-169678942 ATGGAGAAGAGAAACTCGGAGGG + Intronic
1001241947 5:170077894-170077916 CCGGAGAAGAGAGAGAAGGAGGG - Intronic
1001415228 5:171540948-171540970 AAGGAGAAAGGAAAGAAGGAAGG + Intergenic
1001551150 5:172603050-172603072 TTGGAGAAGACAAAGAAACAGGG + Intergenic
1001773578 5:174312707-174312729 ATGGAAAAGAGAAAGAAGGGTGG - Intergenic
1001825733 5:174743427-174743449 ATGGAGAAAGGAAGGAAGGAAGG - Intergenic
1002829172 6:803455-803477 AAGTAGAAGAAAAAGAAGGACGG - Intergenic
1002864614 6:1110022-1110044 AAGGAGAAGTTACAGATGGAAGG + Intergenic
1002899507 6:1399256-1399278 ACGGAGAAGAAAGAGAGGGAGGG + Intergenic
1003320993 6:5051224-5051246 AAGGAGAAGACAAAGAAAAAGGG + Intergenic
1003846136 6:10175245-10175267 ATGGAGAAGAAAAGGCAGGAAGG - Intronic
1003874363 6:10423175-10423197 AGGGAGAAGGTGAAGAAGGAAGG + Intergenic
1003954452 6:11148770-11148792 AAAGAAAAGAGAAAGAAGGAAGG - Intergenic
1004072337 6:12311935-12311957 AGGGTGAAGATAAAACAGGAGGG - Intergenic
1004577029 6:16906831-16906853 GAGGAAAAGAAAAAGAAGGAAGG + Intergenic
1004734023 6:18387024-18387046 AGGGAGAAAATAAAGAAAGGTGG + Intergenic
1004751292 6:18565416-18565438 AGGGAGAAAGGAAAGAAGGAAGG - Intergenic
1004933010 6:20479786-20479808 ATGGACAAGAACAAGAAGGGAGG - Intronic
1005018197 6:21393483-21393505 TGGGAGAAGAAAAGGAAGGAAGG + Intergenic
1005401505 6:25439074-25439096 AAAGAGAAGAAAAACAAGGATGG + Intronic
1005430669 6:25753553-25753575 ATGGAGAAAATAAAAAATAATGG + Intergenic
1005496152 6:26389658-26389680 ATAGAGCAGAACAAGAAGGAGGG + Intronic
1005510280 6:26506346-26506368 ATGAAGGAGGTAAATAAGGAAGG - Intronic
1005580086 6:27225570-27225592 AGAGAGAAGAAAGAGAAGGAAGG - Intergenic
1005691998 6:28315606-28315628 ATGTAGAAGAGAAAGACTGATGG - Intergenic
1005850768 6:29819058-29819080 ATAGAGAAGAAAGAGAGGGAGGG - Intergenic
1005865807 6:29935139-29935161 ATAGAGAAGAAAGAGATGGAGGG - Intergenic
1006057913 6:31399625-31399647 ATGGAGAAAAGAGGGAAGGATGG - Intergenic
1006284098 6:33080189-33080211 ATGGAAAAGAGAAAGAAGGAAGG + Intronic
1006434353 6:34018554-34018576 AGGGAGAAGACAAAGAAAGGTGG - Intergenic
1006876611 6:37303024-37303046 ATGGAGAAGGAAAGGAAGCAAGG + Intronic
1007302335 6:40876684-40876706 AGGAAGAAAAGAAAGAAGGAAGG - Intergenic
1007589980 6:43015107-43015129 ATAGAGAATATAAGGGAGGATGG + Intronic
1007735281 6:43978445-43978467 AAAGAGAAGATAAGGATGGAGGG - Intergenic
1008196818 6:48534486-48534508 TTTGAAAAAATAAAGAAGGATGG + Intergenic
1008362307 6:50635449-50635471 AAGAAGAAAATAAAGATGGAAGG + Intergenic
1008369543 6:50716425-50716447 AGGGAAAAAATAAAGAAGGAAGG + Intronic
1008369552 6:50716473-50716495 AGGGAGAAAAAGAAGAAGGAAGG + Intronic
1008458088 6:51735563-51735585 CTGAAGAATATAAAGAAAGAAGG + Intronic
1008482684 6:52002689-52002711 AAGGAGAAGACAAGGAGGGAAGG + Intronic
1008582581 6:52920414-52920436 ATGGAGGAGATAGAGACGGAGGG - Intergenic
1008697632 6:54059164-54059186 ATGGGGAAGAAAGGGAAGGAAGG - Intronic
1009430275 6:63558291-63558313 ATGGAGGAGAGAAAGAAGCAGGG + Intronic
1009548908 6:65060512-65060534 AGAGAGAAGACCAAGAAGGAAGG - Intronic
1009600785 6:65795026-65795048 AAGGGGAAAATAAAGAAGAAAGG - Intergenic
1009602008 6:65813219-65813241 GGGGAGAGGATAAAGGAGGAGGG + Intergenic
1009653135 6:66502440-66502462 CTGGTGAAAAAAAAGAAGGAAGG + Intergenic
1009803984 6:68578702-68578724 AGGAAAAAGAAAAAGAAGGAAGG + Intergenic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1010357205 6:74948267-74948289 AAGGAGAGGAAAAGGAAGGAAGG + Intergenic
1010815890 6:80357497-80357519 ATAGAGAAGGCAAAGAAGGGTGG + Intergenic
1010890843 6:81308572-81308594 ATGAAGCAGAAAAAGAGGGAGGG + Intergenic
1010909266 6:81533502-81533524 ACAGAAAAGATAAATAAGGAAGG - Intronic
1011131195 6:84053177-84053199 ATAAAGAAAATAAAGATGGAGGG - Intronic
1011214371 6:84989273-84989295 ATGGAAAACATAAAAAAGCAGGG + Intergenic
1011375998 6:86687527-86687549 TTGGAAAAGAGAAAGAATGATGG - Intergenic
1011621008 6:89242612-89242634 ATGGAAAAGGGAAGGAAGGAAGG + Intergenic
1011744784 6:90398959-90398981 AGAGAGGAGAGAAAGAAGGAAGG - Intergenic
1011770422 6:90669747-90669769 ACAGAGAAGAGAAAGAATGAAGG - Intergenic
1012011024 6:93785676-93785698 AAGGAAAAAAGAAAGAAGGAGGG - Intergenic
1012043831 6:94243622-94243644 ATGTAGAAGATAAATAAAGGTGG - Intergenic
1012161951 6:95896724-95896746 TTGAAGAAGATAAAGTACGAAGG - Intergenic
1012218662 6:96620863-96620885 ATGGAGGAAATCAAAAAGGAGGG + Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1012724420 6:102791102-102791124 AAGGAAAACATGAAGAAGGATGG + Intergenic
1012961901 6:105630964-105630986 CTAGAGGAGATAAAGAAGGAGGG + Intergenic
1012970335 6:105722328-105722350 AAGGAGGAGACAAAGAAGGGAGG + Intergenic
1013346986 6:109270250-109270272 AGGGAGAAGGGAAAAAAGGAAGG - Intergenic
1014176216 6:118334240-118334262 ATGAAGAAAGGAAAGAAGGAAGG + Intergenic
1014288633 6:119532690-119532712 ATTGAGCAGAGAAAAAAGGATGG + Intergenic
1014345070 6:120259344-120259366 AAAGAGAGGATAAAGAAGGCAGG - Intergenic
1014428730 6:121341147-121341169 ATGGTGGTGATAAAGAAGGGAGG + Intergenic
1014464286 6:121736848-121736870 ATGGAAAACAGAAAGAAGCAGGG - Intergenic
1014561884 6:122901014-122901036 AGGGAGGAAGTAAAGAAGGAGGG - Intergenic
1014842680 6:126239034-126239056 ATGGAAAACAAAAAAAAGGAAGG - Intergenic
1014866238 6:126533699-126533721 AGGAAGAAAAGAAAGAAGGAAGG + Intergenic
1014892958 6:126864916-126864938 ATGGAAAACATAAAAAACGAGGG - Intergenic
1014986000 6:128010455-128010477 GAGGAGAAGGTAAAGAAGAAAGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015265078 6:131283352-131283374 ATGGAGTAGATCATGATGGAGGG + Exonic
1015484136 6:133749176-133749198 AAGCAGAAGACAACGAAGGATGG + Intergenic
1015577805 6:134691177-134691199 AGGAAGAGGAGAAAGAAGGAGGG + Intergenic
1015846084 6:137522554-137522576 AGGGAGGAGATAGGGAAGGAAGG - Intergenic
1015954125 6:138582767-138582789 ATGGAGGAGATAAAGAGTCAAGG - Intronic
1015973550 6:138767045-138767067 AAGGAGAAGAAAGAGAGGGAAGG - Intronic
1016027305 6:139300422-139300444 ATTGGGAAGATAAAGAGGCAAGG - Intergenic
1016031004 6:139338108-139338130 ATGGAGAAGAACAAAAAGGCAGG + Intergenic
1016170920 6:141015559-141015581 ATGGAGAGGAATAGGAAGGATGG + Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016546474 6:145229616-145229638 AGGAAGAAAAGAAAGAAGGAAGG - Intergenic
1016645810 6:146406876-146406898 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1017284516 6:152658695-152658717 ATGGAAAAAAAAAAAAAGGATGG + Intergenic
1017330458 6:153192300-153192322 ATAGAGAAGATAAATAAGATGGG - Intergenic
1017334085 6:153234559-153234581 AGGGAAAAGAAAAGGAAGGAAGG + Intergenic
1017644826 6:156529213-156529235 ATGAAGAAAAGAAGGAAGGATGG + Intergenic
1017951473 6:159138552-159138574 ACATAGAAGATAAAGAAGAAAGG + Intergenic
1018501154 6:164412344-164412366 ATGGTGAAAATCAAGTAGGAGGG + Intergenic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1019320699 7:414186-414208 AGGGAGAGGATCAAGGAGGAGGG - Intergenic
1019320733 7:414264-414286 AGGGAGAGGATCAAGGAGGAGGG - Intergenic
1019483576 7:1277284-1277306 AGGGAGAAGAGAGGGAAGGAGGG - Intergenic
1019684301 7:2372260-2372282 ATGGAGAAAAGGAGGAAGGAAGG + Intronic
1019863720 7:3685036-3685058 AAGGAGATGAGAAAGAAGGTTGG + Intronic
1019908612 7:4083713-4083735 ATGGAGGAAGTAAAGAAGGGAGG - Intronic
1020062631 7:5164034-5164056 ATATAGCTGATAAAGAAGGACGG + Intergenic
1020227012 7:6288388-6288410 AGGAAGGAGAGAAAGAAGGAAGG - Intergenic
1020314453 7:6895119-6895141 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1020361129 7:7327980-7328002 ATGGGGGAGAGAGAGAAGGAAGG + Intergenic
1020441160 7:8218300-8218322 ATGGAGAAGTTCAGGAAGGTAGG - Exonic
1020451088 7:8321237-8321259 TTGAAGAAGATAAAGAACCAAGG + Intergenic
1020611629 7:10404478-10404500 AAGGAAAAGAAAAAGAAAGAAGG + Intergenic
1020769090 7:12365097-12365119 GTGCAAAAGATAAAGAAAGATGG + Intronic
1020874502 7:13676490-13676512 ATCAAGAAGATAAAGAAAGGGGG - Intergenic
1020878685 7:13730648-13730670 GTGTATAAGAAAAAGAAGGAGGG - Intergenic
1020950120 7:14664888-14664910 AGGAAGAAAAGAAAGAAGGAAGG + Intronic
1020995728 7:15261607-15261629 ATCTAAAAGATAAAGAAAGAGGG + Intronic
1021130052 7:16900474-16900496 ATGGAGAACAAAGAGAAGCAGGG - Intergenic
1021260892 7:18455931-18455953 AAGGATAAAATAAAGAAGCAAGG + Intronic
1021362091 7:19728156-19728178 AAGGAAAAAATAAAAAAGGAAGG - Intronic
1021839600 7:24712118-24712140 ATGGAAAAGAAAAAGAAGAATGG + Intronic
1022012582 7:26321713-26321735 ATGGAGAAGATAATGAAGTAAGG - Intronic
1022135641 7:27445477-27445499 AGGGAGAAAGGAAAGAAGGAAGG + Intergenic
1022229840 7:28404174-28404196 ATGGAAAAGAAAAAGAACTATGG + Intronic
1022370866 7:29770117-29770139 AGGGAGAGGGAAAAGAAGGAGGG - Intergenic
1022651948 7:32285680-32285702 AGGGAGAAGAAGAAGAAAGAAGG + Intronic
1022764045 7:33390093-33390115 AAGGAAAAGGAAAAGAAGGAAGG - Intronic
1022898435 7:34776961-34776983 AAGGAGAAGAAGGAGAAGGAAGG - Intronic
1023075475 7:36478019-36478041 ATAGAGAAGAGAAAGAAGGAAGG - Intergenic
1023139993 7:37092224-37092246 ATATAGAAGATAAAGAAACAAGG + Intronic
1023204170 7:37730157-37730179 AGAGAGAAGAGAAAGAAGGGGGG - Intronic
1023330992 7:39116705-39116727 ATAGAGAAGAGGAAGAAGGTTGG - Intronic
1023339067 7:39200092-39200114 ATGGTGCAGATAAAGAAGCTTGG + Intronic
1023412190 7:39899180-39899202 ATGCAGAAGATAAAAATGAATGG - Intergenic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023613578 7:41995746-41995768 ATGAAGAAAAGAAAGAAGAAAGG + Intronic
1023679155 7:42666252-42666274 ATGGAAAATATAAAAAAGAAGGG + Intergenic
1023710690 7:42989218-42989240 GTGGGGAAGATAAAGAAATAGGG + Intergenic
1023916101 7:44590506-44590528 AGAGAGAAGATAAAGAAAGTGGG + Intergenic
1024161907 7:46684707-46684729 ATGGAGAAGAGAAAGAGGAAAGG - Intronic
1024192724 7:47029182-47029204 TGGAAGAGGATAAAGAAGGAGGG + Intergenic
1024354652 7:48402192-48402214 ATGGAAGAAATGAAGAAGGAGGG + Intronic
1024368903 7:48558130-48558152 ATGGAGAAAGGAAGGAAGGAAGG - Intronic
1024410364 7:49033914-49033936 ATTGGTAAGATAAACAAGGAAGG - Intergenic
1024431446 7:49292668-49292690 ATGGAGAAGATAAAAAGGAATGG + Intergenic
1024439754 7:49403678-49403700 AAGGAGAAGGGAAGGAAGGAAGG + Intergenic
1024481096 7:49864251-49864273 AGAAAGAAGACAAAGAAGGAGGG + Intronic
1025064107 7:55838484-55838506 AGGAAGAAAAGAAAGAAGGAGGG - Intronic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026662834 7:72317224-72317246 AAAGAGAAGAGAAGGAAGGAAGG + Intronic
1026677198 7:72437851-72437873 AGGAAGAAAAGAAAGAAGGAAGG - Intronic
1026780030 7:73259987-73260009 AAGGAGAAGAGGATGAAGGAAGG + Intergenic
1027298912 7:76809394-76809416 ATGGACATGACAAAGAGGGAGGG + Intergenic
1027384798 7:77648949-77648971 AAGGAGAAGAAAGAGAAGGAGGG + Intergenic
1027730018 7:81859492-81859514 ATGGAGAAGAGAAAGCAGAGTGG + Intergenic
1028229484 7:88289296-88289318 ATGGAGAAGAGTAAGAAAGAAGG + Intronic
1028302476 7:89217843-89217865 ATGGAGGATATAAAGAAGAATGG + Intronic
1028347063 7:89796422-89796444 ATGGAAAACAGAAAGAAGCATGG - Intergenic
1028441089 7:90861633-90861655 ATAGTGAAAGTAAAGAAGGAAGG + Intronic
1028456057 7:91039439-91039461 ATGAAAAAGATACATAAGGATGG + Intronic
1028859177 7:95628496-95628518 AGGGAGAAGGTAAAGAACCAAGG - Intergenic
1029015591 7:97312571-97312593 AAGGAAAAGAAAAGGAAGGAAGG - Intergenic
1029073892 7:97921038-97921060 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1029412933 7:100427083-100427105 AAGGAGAAGAGAGAGAGGGAGGG - Intronic
1029412959 7:100427153-100427175 AAGGAGAAGAGAGAGAGGGAGGG - Intronic
1029618113 7:101672620-101672642 AGGAAGAAGGGAAAGAAGGAAGG - Intergenic
1029621380 7:101691907-101691929 AAGGAAAAGAGAAAGAAGGAAGG - Intergenic
1029745203 7:102512577-102512599 AGGGAGAAGAGTAAGAGGGAGGG + Intronic
1029763195 7:102611738-102611760 AGGGAGAAGAGTAAGAGGGAGGG + Intronic
1030042067 7:105460449-105460471 ATGGAGAAGAGAAGGAAATAGGG + Intronic
1030167566 7:106570404-106570426 ATGGAGAAGATAAAAACTGCTGG - Intergenic
1030740184 7:113100287-113100309 AAGGAGAAAAAAATGAAGGAAGG - Intergenic
1030823492 7:114124802-114124824 ATGATGTAGATAAAGGAGGAGGG - Intronic
1030965789 7:115991544-115991566 ATGGAAAACAAAAAAAAGGAGGG + Intronic
1031682881 7:124695853-124695875 AAGGGAAAGAAAAAGAAGGAAGG + Intergenic
1031925587 7:127635183-127635205 ATGGAGAAAACAAAGATGGGTGG + Intergenic
1032123822 7:129176167-129176189 AGGGAAAAGGGAAAGAAGGAAGG + Intergenic
1032386551 7:131529564-131529586 AAGCAGGGGATAAAGAAGGAAGG - Intronic
1032599817 7:133281654-133281676 AAGGAAAAGATAAAGAAGGGAGG - Intronic
1032685643 7:134231463-134231485 AGGGAGGAAACAAAGAAGGAAGG - Intronic
1032907263 7:136383216-136383238 AGGGAGCAGAGAAAGAATGAGGG + Intergenic
1032974495 7:137206772-137206794 AGAGAAAAGAAAAAGAAGGAAGG - Intergenic
1033062047 7:138118839-138118861 AGGGGAAAGAAAAAGAAGGAGGG + Intergenic
1033077241 7:138261036-138261058 ATGGAGAGGTTAAATAATGAAGG + Intergenic
1033107605 7:138543157-138543179 ATGGAGAAAATAAAAATAGATGG + Intronic
1033306419 7:140229306-140229328 AAGGAGCAGTTCAAGAAGGAAGG + Intergenic
1033832587 7:145271469-145271491 AGGAAGAAGAAAAAGAAGGAAGG + Intergenic
1033947685 7:146741846-146741868 ATGGAGAGGGTACCGAAGGATGG + Intronic
1033948208 7:146749054-146749076 ATTGCAAAGAGAAAGAAGGAAGG - Intronic
1034108826 7:148516223-148516245 ATGGATAAGATAAAGAAGAGTGG - Intergenic
1034287694 7:149899687-149899709 AAGGAAAAGAGAAAGAAGGCAGG + Intergenic
1034663434 7:152793234-152793256 AAGGAAAAGAGAAAGAAGGCAGG - Intronic
1034737881 7:153445957-153445979 GTGGAGAAGATAAAGCAGAAAGG + Intergenic
1035500341 8:87309-87331 ATGGAGAGGAGAAAGAAGAGGGG - Intergenic
1035810542 8:2487408-2487430 ATAGAGAAAGGAAAGAAGGATGG + Intergenic
1035873071 8:3156816-3156838 ATGGAGACGATAATTTAGGAGGG + Intronic
1035917854 8:3644513-3644535 ATGGGGAAGATGATGAAAGAGGG + Intronic
1036126600 8:6068630-6068652 AAGGAGAGGAGAAGGAAGGAAGG - Intergenic
1036188837 8:6650836-6650858 AAGGAGGAGAGAGAGAAGGAAGG - Intergenic
1036188840 8:6650855-6650877 ACAGAGAAGAGACAGAAGGAAGG - Intergenic
1036243813 8:7100258-7100280 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036256976 8:7213793-7213815 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036309026 8:7672392-7672414 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036360508 8:8073720-8073742 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036890463 8:12593247-12593269 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036898031 8:12651165-12651187 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1037028412 8:14069970-14069992 AGGAAGAAGACAAGGAAGGAAGG + Intergenic
1037039517 8:14213110-14213132 AAGGAGAGGAGTAAGAAGGAGGG + Intronic
1037147600 8:15592094-15592116 ATGTAGAAGATGAGGAAGGAAGG + Intronic
1037298458 8:17426424-17426446 AAGGAGAAGAGAAACAAGAAGGG + Intergenic
1037774415 8:21823437-21823459 AAGGAGAGAAGAAAGAAGGAGGG - Intergenic
1038009408 8:23462902-23462924 AAGAAGAAGAAAGAGAAGGACGG - Intergenic
1038067540 8:23978642-23978664 AGGAAGAAGAAAAAGAAAGAAGG + Intergenic
1038101818 8:24386665-24386687 ATGGAATAGATACAGTAGGAAGG - Intronic
1038537491 8:28364021-28364043 AAGCAGAAGAGAAAGAAGGAAGG + Intronic
1038890200 8:31713021-31713043 AGGCAGAAAAGAAAGAAGGATGG - Intronic
1038945353 8:32353481-32353503 ATAAAGAAGATAAAGAAAAATGG + Intronic
1039016856 8:33159142-33159164 AAGAAGAAGAGAAAGAATGAAGG - Intergenic
1039142741 8:34411146-34411168 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1039201854 8:35103939-35103961 ATAGGGAAGATAAATAAGGCAGG - Intergenic
1039874093 8:41570670-41570692 AGAGAGAAAAGAAAGAAGGAAGG + Intergenic
1040445969 8:47493995-47494017 AAGGAGAAAAGAAGGAAGGAGGG - Intronic
1040537178 8:48320625-48320647 AAGGGGAAAATAAAGGAGGAAGG + Intergenic
1040559131 8:48508468-48508490 TTGGAGATGATAAAGGAGGGTGG + Intergenic
1040576303 8:48654382-48654404 ATGGAAGAGAGGAAGAAGGAAGG - Intergenic
1040622609 8:49106548-49106570 ATGGAGAAGACATGGAAGGTGGG - Intergenic
1040654367 8:49488443-49488465 AGGGAGAGAAGAAAGAAGGAAGG + Intergenic
1041150811 8:54931742-54931764 AAGTAAAAGAGAAAGAAGGAAGG - Intergenic
1041453372 8:58031844-58031866 AGGGAGAGAAGAAAGAAGGAAGG - Intronic
1041578278 8:59425284-59425306 ATGCAGAACTTAAAGAAGAAAGG + Intergenic
1041631238 8:60089818-60089840 ATGGGAAGGACAAAGAAGGAGGG - Intergenic
1041854922 8:62440675-62440697 AAGAAGAAGAAAAAGAAGGAAGG - Intronic
1041890155 8:62859223-62859245 ATGGAGAAGAAAGAAAAGCAGGG - Intronic
1042021544 8:64374650-64374672 AAGGAGAAAATAAAAAACGAAGG + Intergenic
1042042780 8:64611254-64611276 ATGGAGGTGATTAAGAAGAAAGG - Intronic
1042056534 8:64769981-64770003 AAAGATGAGATAAAGAAGGATGG - Intronic
1042279171 8:67036775-67036797 AGGGGGAAGAAAAGGAAGGAAGG - Intronic
1042311056 8:67379812-67379834 AAGGAGAAGAAAGAGAAAGAGGG - Intergenic
1042397806 8:68311851-68311873 AGGGGGAAGGGAAAGAAGGAAGG - Intronic
1042555816 8:70033116-70033138 AGGGAGAGGAGAAAGGAGGAAGG + Intergenic
1042566953 8:70121315-70121337 ATGGATATGATTAAGCAGGAGGG - Exonic
1042986685 8:74592134-74592156 ATGGAGAAGTAATAGAATGATGG - Intergenic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043764238 8:84109399-84109421 ATGAAAAAGAAAAATAAGGAAGG - Intergenic
1043766246 8:84135753-84135775 AAAGAAAAGAAAAAGAAGGAAGG + Intergenic
1044185509 8:89245966-89245988 AGGGAGGAGAGAAGGAAGGAAGG - Intergenic
1044245491 8:89939762-89939784 GTGTAGAAGGTAAAGAAGCAGGG + Intronic
1044331054 8:90920762-90920784 ATGGGGGAGATAAACAAGGAAGG - Intronic
1044458690 8:92419055-92419077 ATGGAGAAGAAAGAAAGGGAAGG + Intergenic
1044461017 8:92443937-92443959 ATGGAGAAGTTTCAAAAGGACGG + Intergenic
1044746170 8:95373530-95373552 ATGGAAAACATAAAAAAGCAGGG - Intergenic
1044758666 8:95493601-95493623 ATCGAGAAGAAAAAGGAGAAAGG + Intergenic
1044785282 8:95786857-95786879 AAGGAAAAGAGAAAGAAGGCAGG + Intergenic
1044899250 8:96926522-96926544 AAGAAGAAGAAAAAGAAGAAAGG - Intronic
1045205225 8:100032335-100032357 ATGGAAAACAAAAAAAAGGAGGG + Intronic
1045454467 8:102363474-102363496 AGGGAGAAGATAAACAAGGGTGG + Intronic
1045825531 8:106393019-106393041 GTGGAGAAGTTGGAGAAGGATGG - Intronic
1045866437 8:106871212-106871234 AAGGGGAACATAGAGAAGGAAGG - Intergenic
1045875706 8:106978489-106978511 AAGGAGAGGAAAAAGATGGACGG + Intergenic
1045957032 8:107920116-107920138 AGGAGGAAGAGAAAGAAGGAGGG + Intronic
1046016036 8:108606409-108606431 AGAGGAAAGATAAAGAAGGAAGG - Intergenic
1046085455 8:109428453-109428475 GTGGAGAAGATAAGGAAGTGGGG + Intronic
1046173945 8:110550103-110550125 AGGGAGAGGAGAAAGAAGGTTGG + Intergenic
1046221252 8:111218429-111218451 AGGGAAAGGAAAAAGAAGGAAGG - Intergenic
1046236837 8:111435205-111435227 AAGGAAAAGAAAAGGAAGGAAGG + Intergenic
1046282926 8:112057501-112057523 ATGGAAAACATAAAAGAGGAGGG - Intergenic
1046397279 8:113656759-113656781 ATCTGGAAGATAAAGAAGGAGGG + Intergenic
1046558441 8:115806744-115806766 AAGAAGAAGAAAGAGAAGGAAGG + Intronic
1046558452 8:115806845-115806867 AGGAAGAAGAATAAGAAGGAAGG + Intronic
1046671889 8:117065353-117065375 ATTTAGAACCTAAAGAAGGAAGG + Intronic
1046756106 8:117974383-117974405 ATGGAGCAGATGAGGAAGCATGG - Intronic
1046820856 8:118632804-118632826 ATGGAAAAAAGAAAGAATGAAGG - Intergenic
1046957898 8:120080674-120080696 GTGAAGAAGAGAAAGAGGGAAGG + Intronic
1047365242 8:124205253-124205275 ATGTAGAAGATATAGAAGAATGG + Intergenic
1047464517 8:125099454-125099476 AAGGAGAAGAAAAAGAAGCTTGG + Intronic
1047514829 8:125544919-125544941 ATGGGCAAGAGAAAGAAGGGTGG + Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048230998 8:132641548-132641570 AAGGAGAAAAGAAAGAATGAGGG + Intronic
1048268221 8:133005942-133005964 AGGGAGAAGATGGAGTAGGAGGG - Intronic
1048278048 8:133082203-133082225 ATAGAAAAGATAAGGAAGGTTGG - Intronic
1048366199 8:133740762-133740784 ATGGAGAACATAAGGAGGGATGG + Intergenic
1048366402 8:133742529-133742551 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
1048519697 8:135142110-135142132 AGGGAGAAGGAATAGAAGGAAGG + Intergenic
1048590914 8:135820140-135820162 AGGGAAAAGAAAAAGAAGCAAGG - Intergenic
1048637964 8:136320116-136320138 ATGGAGAGAATAAAGAAGTGAGG - Intergenic
1048859618 8:138714408-138714430 ATGGAGAGGACAGAGAAGGACGG + Intronic
1049108690 8:140629535-140629557 AGTGAGAAGATGAAAAAGGAGGG + Intronic
1049929760 9:444995-445017 ATGAAGAAGATAATGGAAGAGGG + Intronic
1050010425 9:1180316-1180338 AAGGAGAAGAGGAAGCAGGAAGG - Intergenic
1050159651 9:2704260-2704282 ATGGAGAAGAAAAATAAATAAGG + Intergenic
1050408899 9:5340548-5340570 AAGAAGAAGAGAAAGAAGAAGGG + Intergenic
1050419031 9:5443651-5443673 TTGGAGAAGATAAAAATGTAAGG + Intergenic
1050446924 9:5733886-5733908 ATAGAGAAGACAAAGAAGGGAGG - Intronic
1050475911 9:6040925-6040947 AAGGAGAAGATGAAGAAGTAAGG - Intergenic
1050475918 9:6040989-6041011 AAGGAAAAGAGGAAGAAGGAAGG - Intergenic
1050570043 9:6928309-6928331 ATAAAGAAGGTAAAGAAAGAGGG - Intronic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050753633 9:8972482-8972504 GTGTAGAAGAAAAAGAAGAAAGG + Intronic
1050891382 9:10828936-10828958 ATAGAAAACATAAAGAAGCAGGG - Intergenic
1051014975 9:12463241-12463263 AGGGAGAAAGGAAAGAAGGAAGG - Intergenic
1051014986 9:12463292-12463314 AGGGAGAAAGGAAAGAAGGAAGG - Intergenic
1051014999 9:12463355-12463377 AGGGAGAAAGGAAAGAAGGAAGG - Intergenic
1051141424 9:13983580-13983602 ATGGAGAATGTAAAGAAGAATGG - Intergenic
1051400778 9:16679726-16679748 ATGGAGAGGAAAAGGCAGGAAGG + Intronic
1051403462 9:16708559-16708581 ATGGACAAAAGAGAGAAGGAAGG + Intronic
1051449643 9:17181140-17181162 AGGTAGAAGAGAAAGAAGGCAGG - Intronic
1051502551 9:17793689-17793711 ATAGAGAAGAATGAGAAGGAAGG - Intronic
1052025398 9:23568308-23568330 AAAGGGAAGATAAAGAAAGATGG - Intergenic
1052027298 9:23587846-23587868 AGGAAGAAGTAAAAGAAGGAGGG + Intergenic
1052111477 9:24589282-24589304 ATAGAGAAGAAAAAGAATGGGGG + Intergenic
1052130698 9:24843276-24843298 ATGAAGAAGAGAATGAAGGAAGG - Intergenic
1052141092 9:24984929-24984951 ATGGAGAAGGGAAAGGAGAAAGG + Intergenic
1052353242 9:27478587-27478609 ATGGAGCAGAGAAAGAAAAAAGG + Intronic
1052417076 9:28189900-28189922 ATGGAGAAGAGAGAGAAGAGGGG + Intronic
1052492238 9:29184691-29184713 AGGGAGGAGAGAAGGAAGGAAGG - Intergenic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053306530 9:36988016-36988038 AGCGAGAAGATGAAGAAGGAGGG + Intronic
1053466839 9:38314744-38314766 AGGGAGAAAGGAAAGAAGGAAGG - Intergenic
1053474309 9:38370979-38371001 AAGGCTAAGATAAGGAAGGAGGG + Intergenic
1053486893 9:38465354-38465376 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1053526222 9:38833275-38833297 ATCTAGAAGATAAAGAAATATGG + Intergenic
1053636994 9:40019018-40019040 ATGCAGGAGACAAAGAAGGCAGG - Intergenic
1054198448 9:62057699-62057721 ATCTAGAAGATAAAGAAATATGG + Intergenic
1054639905 9:67530662-67530684 ATCTAGAAGATAAAGAAATATGG - Intergenic
1054728297 9:68674875-68674897 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
1054846547 9:69804683-69804705 ATGTAGAAAATAGGGAAGGAAGG - Intergenic
1055291720 9:74788581-74788603 ATGCAGAAGATAAAGGTAGATGG + Intronic
1055528778 9:77162120-77162142 AAGGAGAAGATTTAGAAAGATGG + Intergenic
1055595075 9:77857617-77857639 GTGGGGAAGAAAAGGAAGGACGG + Intronic
1055615836 9:78071381-78071403 ATAAAGAATATAAAGAAGGCTGG - Intergenic
1055703455 9:78971819-78971841 ATGGAGAAAAGAAGGAGGGAGGG + Intergenic
1055713086 9:79086877-79086899 AGAGAGAAGAAAGAGAAGGAAGG + Intergenic
1055729843 9:79269171-79269193 ATGAAGAACATATCGAAGGAAGG + Intergenic
1055806024 9:80094479-80094501 ACATAGAAGAAAAAGAAGGAAGG - Intergenic
1055834285 9:80419960-80419982 ATGGAGAACAGAAAAAAGCAAGG - Intergenic
1055911502 9:81358056-81358078 GTGAAGAAAATAAAAAAGGAGGG - Intergenic
1056552934 9:87665915-87665937 ATTGAAAAGATATAGAAAGATGG - Intronic
1056838153 9:89974653-89974675 AGGCATGAGATAAAGAAGGATGG + Intergenic
1057006306 9:91563702-91563724 AGGGAGAGAAGAAAGAAGGAAGG + Intronic
1057101493 9:92365199-92365221 GGGGAGAAAATAAACAAGGATGG + Intronic
1057640003 9:96810337-96810359 AGGTAGAAGACAAATAAGGAAGG + Intergenic
1057961095 9:99457826-99457848 AGGGAGAAGGGAAGGAAGGAGGG + Intergenic
1057995284 9:99817333-99817355 GTGGAGAAGAAGAGGAAGGAGGG + Intergenic
1058204024 9:102079534-102079556 ATAGAGAGGATAAATAAAGAGGG - Intergenic
1058319923 9:103616036-103616058 ATGAAGGAGAAAAGGAAGGAAGG + Intergenic
1058339456 9:103876577-103876599 ATTGAAAACATAAATAAGGAAGG + Intergenic
1058618535 9:106860937-106860959 ACCGAGAAGAGAAAGAAGAAAGG - Intergenic
1058872671 9:109216143-109216165 ATGGAAAAGAGAAAGAGGGGAGG - Intronic
1058944875 9:109846809-109846831 TTGGAGCTGCTAAAGAAGGAAGG - Intronic
1059013292 9:110486593-110486615 ATGAAGCAGAGAAAGAAGGAAGG - Intronic
1059183187 9:112239792-112239814 AGGAAGAAGAAAAGGAAGGAAGG + Intronic
1059483421 9:114609717-114609739 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1059568112 9:115404097-115404119 AAGGAGAAGAAAAAGAAGAGGGG - Intergenic
1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG + Intergenic
1059672251 9:116502811-116502833 AAGAAGAAGAGAATGAAGGAGGG + Intronic
1059795146 9:117686511-117686533 AGGAAGAAGATAAAAAAAGATGG - Intergenic
1059865253 9:118506849-118506871 ATGGAGAACAAAAAGAAGCCAGG + Intergenic
1059871256 9:118580504-118580526 TTTGAGAAGGTACAGAAGGATGG + Intergenic
1060248000 9:121962480-121962502 TTGAAGAACATAAAGAAGGTGGG - Intronic
1060321628 9:122567125-122567147 ATTGAAAAGAGAAAGAATGAAGG - Intergenic
1060419928 9:123461125-123461147 ATGAAGAAGGTGAGGAAGGAAGG - Intronic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1061267758 9:129517450-129517472 AAGAAGAAGAGAAAGAAAGAAGG - Intergenic
1061368274 9:130183770-130183792 AGGGAAAAGAAAAGGAAGGAAGG - Intronic
1061594509 9:131620207-131620229 ATGGAGAAGATGCCCAAGGATGG + Intronic
1061660334 9:132125903-132125925 ATGGAGAAGAGAACACAGGAGGG - Intergenic
1061868662 9:133508355-133508377 ATGAAGAAAGTAAGGAAGGAAGG - Intergenic
1062085579 9:134646360-134646382 AAGGAGAAGAGAAGGAGGGAAGG - Intronic
1062608501 9:137360443-137360465 AAGAAGAAGAAAAGGAAGGAAGG - Intronic
1062675417 9:137740323-137740345 GTGGAGAACATCAAGAAGGGGGG - Intronic
1203635032 Un_KI270750v1:102351-102373 ATGGAGTAGAGAAAGAGGGAAGG + Intergenic
1185486015 X:482090-482112 AGGGAGGAAAGAAAGAAGGAAGG + Intergenic
1185529606 X:806980-807002 AGGGAGGAAAGAAAGAAGGAGGG + Intergenic
1185574782 X:1162840-1162862 AAGGAAAAGAAAAGGAAGGAAGG + Intergenic
1185598698 X:1324503-1324525 AAGGAGGAGGGAAAGAAGGAAGG + Intergenic
1185613730 X:1407793-1407815 ACAGAGAAGATAAAGGAGGAAGG + Intronic
1185680049 X:1881111-1881133 AAGGAAAAGAAAAGGAAGGAAGG + Intergenic
1185680062 X:1881193-1881215 AAGGAAAAGAAAAAGAGGGAAGG + Intergenic
1185690853 X:2154146-2154168 AGAGAGAAGAGAGAGAAGGAAGG - Intergenic
1185726568 X:2426557-2426579 ATGAAGAAAAGAAAGAGGGAAGG - Intronic
1185766892 X:2732873-2732895 AGGGAGAGAAGAAAGAAGGAAGG - Intronic
1185933315 X:4227741-4227763 AAGGAGAAAGTAAGGAAGGAAGG - Intergenic
1186009662 X:5115440-5115462 TGGGAGCAGATAGAGAAGGATGG + Intergenic
1186061207 X:5709519-5709541 ATGAAGAAAATACACAAGGATGG + Intergenic
1186064114 X:5743001-5743023 AAGAAGAAGAAAAGGAAGGAAGG + Intergenic
1186077694 X:5898371-5898393 ATGGCGGAGAAAAGGAAGGAAGG - Intronic
1186137014 X:6532748-6532770 AGGGAGAAAGGAAAGAAGGAAGG - Intergenic
1186267272 X:7844550-7844572 AGGGAGAAAGGAAAGAAGGAAGG + Intergenic
1186297718 X:8169101-8169123 AGGGAGAAAGGAAAGAAGGAAGG - Intergenic
1186325141 X:8467370-8467392 AGGGAGAAAGGAAAGAAGGAAGG + Intergenic
1186330978 X:8534030-8534052 ATGGAGAAAGGAAACAAGGAAGG + Intronic
1186342560 X:8659625-8659647 AAAGAGAAAAGAAAGAAGGAAGG - Intronic
1186539557 X:10386610-10386632 ATGGACAAGAAGAAGAAGAAGGG + Intergenic
1186924700 X:14320435-14320457 AAGGAGAAGAGAAACAAGGATGG - Intergenic
1186985630 X:15010760-15010782 AGTGAGAAAAGAAAGAAGGAAGG + Intergenic
1187211416 X:17236114-17236136 ATTAAGAAGAAAAAGAAGAAAGG - Intergenic
1187264464 X:17718586-17718608 AGGGAGGAAAGAAAGAAGGAAGG + Intronic
1187484792 X:19693339-19693361 AGGAAGGAGAGAAAGAAGGATGG + Intronic
1187515400 X:19965188-19965210 AAGGAAAAAATAAAGAAAGAAGG - Exonic
1187718168 X:22124365-22124387 ATGGAGAAAACAAACAAGAAAGG - Intronic
1188009024 X:25038713-25038735 ATGAAGAATGGAAAGAAGGATGG + Intergenic
1188142836 X:26573700-26573722 AAGGAGAATGAAAAGAAGGAAGG - Intergenic
1188321073 X:28737956-28737978 ATGTAGAAAAGAAGGAAGGAAGG + Intronic
1188331807 X:28881931-28881953 AAGGAGAAGAGAGAGATGGACGG + Intronic
1188379009 X:29468457-29468479 GTGGACATAATAAAGAAGGATGG - Intronic
1188436371 X:30163857-30163879 ATGGAGAAGAGAAGGTAGGGTGG + Intergenic
1188561422 X:31472694-31472716 ATGCTGAAGATAAATAAGGATGG + Intronic
1188591002 X:31834858-31834880 AAGGAGAAAAAAAAAAAGGAAGG + Intronic
1188741190 X:33784667-33784689 AAGGAAAAGAAAAAGAAAGAAGG - Intergenic
1188748848 X:33881131-33881153 AGGAAGAAAATAAAAAAGGAAGG - Intergenic
1188851332 X:35136350-35136372 ATGGAAAAAAGAAAGAAGTAGGG - Intergenic
1188980182 X:36720425-36720447 AAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1189314152 X:40041920-40041942 AAGGAGAGGAGAAGGAAGGAGGG + Intergenic
1189426009 X:40900655-40900677 AAGGAGAGGATAAAGAGGGTAGG + Intergenic
1189658198 X:43268903-43268925 AAGGAGAGGATAACAAAGGAAGG + Intergenic
1190114412 X:47617045-47617067 ATTTAGAAAAAAAAGAAGGAAGG + Intronic
1190126198 X:47707796-47707818 GTTGAGAAGATAGAGGAGGAGGG + Intergenic
1190553607 X:51611576-51611598 ATGGAGAGGAAAGAGAAAGAAGG - Intergenic
1190759569 X:53428239-53428261 ATGGAGAAGATACCCCAGGAGGG - Intronic
1190922573 X:54869813-54869835 AAGGAGAAGAGAAAAAGGGAGGG - Intergenic
1190923059 X:54875312-54875334 ATTGAGCACATAAAGAAAGAAGG - Intergenic
1191676287 X:63795359-63795381 GAGGAGAAGGGAAAGAAGGAAGG + Intergenic
1191915419 X:66196306-66196328 ATAGAGTAGATAAATAAAGATGG + Intronic
1192039503 X:67603478-67603500 TAGGAGAAGGTGAAGAAGGAAGG + Intronic
1192179770 X:68909198-68909220 AGGAAGAAGGGAAAGAAGGAGGG - Intergenic
1192672594 X:73161513-73161535 ATGGAAAGGAAAAAGAAGAATGG - Intergenic
1192825415 X:74691158-74691180 ATGGAGAACAAAAAAAAGCAGGG - Intergenic
1193234656 X:79092266-79092288 ATAGAAAAGATATAGAAAGATGG - Intergenic
1193501794 X:82285405-82285427 AAGAAGAAAAGAAAGAAGGAGGG + Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193624716 X:83804021-83804043 ATGGAGATGATGAAGAAAAATGG + Intergenic
1193742981 X:85241271-85241293 CTGGAGAGGAGAGAGAAGGAGGG + Intergenic
1193860404 X:86659067-86659089 TTGGATAACATAAAGAAAGAAGG - Intronic
1193996374 X:88369931-88369953 ATGGAAAAGATTAAGAAAGCAGG - Intergenic
1194087562 X:89547692-89547714 TAGGAGAAAAGAAAGAAGGAAGG + Intergenic
1194140546 X:90203738-90203760 AAGGTAAAGAGAAAGAAGGAGGG - Intergenic
1194265199 X:91744456-91744478 ATAGAGAAGACAGAGAAAGATGG - Intergenic
1194352017 X:92832788-92832810 TTGAAGAAGACAAAGAATGATGG - Intergenic
1194363776 X:92988654-92988676 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1194546923 X:95247722-95247744 AAGGAGAATAGAAAGAAGGTAGG - Intergenic
1194861979 X:99010709-99010731 AGGGAGAAGGGAAGGAAGGAAGG + Intergenic
1195125354 X:101803544-101803566 ATGGAGATTATGAAGAAGTATGG - Intergenic
1195207925 X:102622719-102622741 ATGGAGAACAGAAAAAAGCAGGG - Intergenic
1195252893 X:103065242-103065264 TTGGGGAAGAAATAGAAGGAAGG - Intergenic
1195530565 X:105950500-105950522 ATGGAGAAAATAAAGGAAAAAGG + Intronic
1195569759 X:106385139-106385161 TTGGAGAAGACAAAAAGGGAGGG - Intergenic
1195614043 X:106898837-106898859 AGGGAGAAGGAAAAGAAAGATGG + Intronic
1195725748 X:107914267-107914289 ATGGAGGAAATAAAGAAGATTGG + Intronic
1195870556 X:109480988-109481010 GGGAAGAAGAGAAAGAAGGAAGG + Intronic
1196001615 X:110793414-110793436 AGGGAGGAGGTAAAGAAGGAAGG - Intronic
1196232639 X:113241586-113241608 ATGGAGAGCATAAACAAGCATGG + Intergenic
1196313858 X:114199645-114199667 AGGAAAAAGAAAAAGAAGGAGGG + Intergenic
1196395223 X:115253775-115253797 AGGAAGAAGACATAGAAGGAAGG + Intergenic
1196500924 X:116380995-116381017 AGGGAAAAGATAAAAAAAGATGG - Intergenic
1196512324 X:116526291-116526313 AAGGAGAGGAGACAGAAGGAGGG + Intergenic
1196852426 X:119950089-119950111 AGGGAGAGGGTAAGGAAGGAAGG - Intergenic
1196855789 X:119982294-119982316 AAAAAGAAGAGAAAGAAGGAAGG - Intergenic
1196942489 X:120791089-120791111 AAGAAGAAGAAAAAGAAAGAAGG - Intergenic
1196981616 X:121220659-121220681 GTGAAGAAGATGAAGAATGAGGG - Intergenic
1197165272 X:123370245-123370267 AGGGAGAAGGAAAAGTAGGATGG - Intronic
1197171609 X:123441046-123441068 ATGCAGAAAATAAAGAAGACAGG + Intronic
1197453850 X:126652445-126652467 AAGGATAACATAAGGAAGGAGGG - Intergenic
1197522931 X:127521839-127521861 ATGGAAAAGAGAAAAAAGTAGGG + Intergenic
1197672201 X:129290251-129290273 ATGGAAAACAAAAAAAAGGAGGG + Intergenic
1197816094 X:130500181-130500203 AGGAAGAAAAGAAAGAAGGAAGG - Intergenic
1197816610 X:130504700-130504722 AGGAAGAAGGGAAAGAAGGAAGG - Intergenic
1197816632 X:130504779-130504801 AGGAAGAAGGGAAAGAAGGAAGG - Intergenic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1198082407 X:133252204-133252226 GAGGAGAAAAGAAAGAAGGAAGG + Intergenic
1198174749 X:134144229-134144251 AGGGAGAAAATAAAAAAGGAGGG + Intergenic
1198325158 X:135564008-135564030 AAGGAGAAGAGAAAGAAAGTGGG - Intronic
1198727915 X:139696325-139696347 GGAGAGAAGAGAAAGAAGGAAGG - Intronic
1199100239 X:143790974-143790996 ATTGAGAAAACAAAGATGGAAGG - Intergenic
1199331463 X:146565548-146565570 AGGGAGAGAATAAAGAAGCAAGG + Intergenic
1199340124 X:146667868-146667890 AGGGAGAAGACAAGGAAGTAAGG - Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199662053 X:150061473-150061495 ATGGCAAAAAGAAAGAAGGAGGG - Intergenic
1199680027 X:150217863-150217885 ATGTAGAAGATAAAGTTGAAGGG + Intergenic
1199778525 X:151037116-151037138 ATAAACAAGATAAAGAAGTAGGG + Intergenic
1199881881 X:151980238-151980260 ATGGTGAAGATAAAAACAGAGGG + Intergenic
1200440207 Y:3203562-3203584 TAGGAGAAAAGAAAGAAGGAAGG + Intergenic
1200486305 Y:3772843-3772865 AAGGTAAAGAGAAAGAAGGAGGG - Intergenic
1200582351 Y:4964904-4964926 ATAGAGAAGACAGAGAAAGATGG - Intergenic
1200660325 Y:5949474-5949496 TTGAAGAAGACAAAGAATGATGG - Intergenic
1200672008 Y:6104893-6104915 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1200899858 Y:8418566-8418588 ATGGAAAACATAAAAAAGGAGGG + Intergenic
1201058015 Y:10015291-10015313 ATAGAGAAGAAAGAAAAGGAAGG + Intergenic
1201381936 Y:13389765-13389787 TTGGACAAGATAAACAAGGCTGG - Intronic
1201461518 Y:14230648-14230670 AAGGAGAAAGAAAAGAAGGAAGG + Intergenic
1201517700 Y:14835664-14835686 ATGGAGACAAAAAAGAAGGAAGG + Intronic
1201549828 Y:15208158-15208180 AAGAAGAAAAGAAAGAAGGAAGG + Intergenic
1201587328 Y:15575515-15575537 AGTGTGAAGATAAAGGAGGATGG - Intergenic
1201625756 Y:16012501-16012523 ATGGAGGGAATAAAGAAGGGAGG + Intergenic
1201798672 Y:17928758-17928780 AGGAAGGAAATAAAGAAGGAAGG + Intergenic
1201802881 Y:17977199-17977221 AGGAAGGAAATAAAGAAGGAAGG - Intergenic
1201907433 Y:19100177-19100199 AAGGAGGAGCTAAAGAAGAAAGG - Intergenic
1201928426 Y:19315235-19315257 AGGAAGAAGAAAAAGAAGAAGGG - Intergenic
1201988081 Y:19991688-19991710 ATGGAGAACAAAAAAAAGGCAGG - Intergenic
1202359989 Y:24097405-24097427 AGGAAGGAAATAAAGAAGGAAGG + Intergenic
1202510788 Y:25572709-25572731 AGGAAGGAAATAAAGAAGGAAGG - Intergenic