ID: 1010116723

View in Genome Browser
Species Human (GRCh38)
Location 6:72321217-72321239
Sequence AAACTACAACAGATATATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010116723 Original CRISPR AAACTACAACAGATATATCA AGG Intronic
905325704 1:37150635-37150657 ATACTTCAACAGAGATACCAGGG - Intergenic
905741843 1:40377913-40377935 GCACTACAACATTTATATCAGGG - Intronic
905787962 1:40773028-40773050 AAACAAGAACACAGATATCATGG + Intergenic
907094063 1:51759497-51759519 ATACTAAAACAGAAATATAAGGG - Intronic
907172838 1:52487028-52487050 AAAATACTACAGAAATATAAAGG - Intronic
907758647 1:57336210-57336232 AAACGACAAGAGCTATAACAAGG - Intronic
907841854 1:58165915-58165937 AAACAACAACAGCTATCTCATGG - Intronic
908932702 1:69336819-69336841 AAACAAAAACAGATATAAGAAGG - Intergenic
909360363 1:74751939-74751961 AAACCTCAACAGAAATCTCAAGG - Intronic
909416442 1:75411345-75411367 AAACTTCAAGAGATATCTGAAGG + Intronic
909724221 1:78814528-78814550 AAACTAAAAAATATATGTCAAGG - Intergenic
910293852 1:85624850-85624872 AAACTACAGCAGTAATATAAAGG + Intergenic
910561369 1:88595659-88595681 CAACTAGAACATATATATAATGG - Intergenic
910588474 1:88903595-88903617 AAACTACAACAGTTCAATCCAGG + Intergenic
911900511 1:103497493-103497515 AAACTACCACATATTTATGATGG + Intergenic
911939506 1:104023508-104023530 AAAATACAACAGATAGGTCTTGG - Intergenic
912943496 1:114066028-114066050 AAACTACAACAGCTCAATCCAGG - Intergenic
919598010 1:199588699-199588721 AAATTTAAACTGATATATCAAGG - Intergenic
920197691 1:204240229-204240251 AAACTACAACAGCTTAATCCAGG + Intronic
921490185 1:215765995-215766017 AAAATAGAACAGCTGTATCATGG + Intronic
922181675 1:223240830-223240852 AAACTACAAGAGATATTAAAAGG - Intronic
922817558 1:228460742-228460764 AACATACAATAGATATATTATGG - Intergenic
923253324 1:232197582-232197604 AAACTACAACAGCCAAATCCTGG - Intergenic
1063833418 10:9983584-9983606 AATGTACTACATATATATCATGG - Intergenic
1063863390 10:10337384-10337406 AAACCTGAACAGATGTATCAAGG - Intergenic
1065109729 10:22427787-22427809 AAACTACAACAAATCTATGTGGG + Intronic
1068007403 10:51407718-51407740 AAACTACAACAGTTCAATCCAGG - Intronic
1070049589 10:72874808-72874830 AATCAGCAAGAGATATATCAAGG - Intronic
1070107918 10:73453677-73453699 ATACTACAACAAAGATATGAGGG + Intronic
1070568607 10:77623104-77623126 AAACTAAAACAGCTATCTCCAGG - Intronic
1071944913 10:90633610-90633632 ACACTATAAGAGATATATGAGGG + Intergenic
1074039671 10:109775850-109775872 AAACTTCAGCAAAAATATCAGGG + Intergenic
1074665627 10:115720018-115720040 AAAATACAAAAAATATATCCAGG - Intronic
1075850566 10:125583174-125583196 AATTTACAACATATGTATCAGGG - Intronic
1078236299 11:9487852-9487874 AAACTATAACAGGTATTTCAGGG - Intronic
1078909283 11:15716154-15716176 AAACTCCACAAGAAATATCATGG - Intergenic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079540605 11:21569236-21569258 AAACTACAACACTTAAAACAAGG + Intronic
1079659638 11:23021859-23021881 AAACTCCAACTAAAATATCAGGG - Intergenic
1088413258 11:109559904-109559926 AAAATACAAAAGATTTTTCAAGG - Intergenic
1090357897 11:126152333-126152355 AAATTACAACAAATGTAGCATGG - Intergenic
1092321663 12:7482955-7482977 AAGCCACAACAGGTATATCATGG - Exonic
1093050177 12:14495298-14495320 AAACTACAACATATGTGTGATGG - Intronic
1093167260 12:15818410-15818432 AAACTGCAATAAAAATATCACGG + Intronic
1094144046 12:27210507-27210529 AAACTATATCAGTTATATAAAGG - Intergenic
1094740488 12:33282845-33282867 AAACTACAAAAGATCTAGCCAGG + Intergenic
1096341092 12:50800402-50800424 AAACAGCAACAGAAATATCTGGG + Intronic
1098662599 12:73115622-73115644 AGACAACATCATATATATCAAGG + Intergenic
1099472763 12:83071625-83071647 AAACAACAACAAAAATATCCAGG - Intronic
1100126076 12:91427354-91427376 AATATACAACAGATATAAAAGGG + Intergenic
1100544863 12:95591821-95591843 AAACTACAACAGCTCCATCCAGG + Intergenic
1101483557 12:105128224-105128246 AAACTACAACAGATTTAGGCAGG + Intronic
1105266165 13:18818020-18818042 TAACTACAACAGACTTTTCAGGG + Intergenic
1105824939 13:24113915-24113937 AAACACCAACAGAAGTATCAAGG + Intronic
1106160382 13:27196110-27196132 AAACCAAAAAAGATATAGCATGG + Intergenic
1106905954 13:34408954-34408976 GAAATACAAGAGATTTATCAGGG + Intergenic
1107142567 13:37017749-37017771 AAACTAGAACAAATTTATGAGGG - Intronic
1107566663 13:41611922-41611944 AAAATACTACCTATATATCAAGG + Intronic
1107637920 13:42411626-42411648 AAACTACAAGAGATATAGACTGG - Intergenic
1108391848 13:49954720-49954742 AAACAACAGAAGATATTTCAAGG - Intergenic
1109648240 13:65289992-65290014 AAAATAAAACAGATAAAGCAAGG - Intergenic
1109852279 13:68081411-68081433 AGAGTACAACAGTTATAACATGG + Intergenic
1111150043 13:84241138-84241160 AAACTATATCACATATATTAGGG - Intergenic
1111198782 13:84906735-84906757 AAACTACAACAGCTCAATCCAGG + Intergenic
1111363368 13:87207156-87207178 AAACTACAACAGCTCAATCCAGG - Intergenic
1111375863 13:87378726-87378748 AAACTACAATGGTTATATTAAGG + Intergenic
1111928797 13:94492252-94492274 AAACTTCAACTGAAATATCCAGG + Intergenic
1112297008 13:98196947-98196969 AAAATACAACAGATGTGTAAAGG - Intronic
1116251869 14:42495774-42495796 ATACTAAATCAGATATGTCATGG + Intergenic
1116758167 14:48975343-48975365 AAACTACTATAAATATATTATGG + Intergenic
1117185616 14:53237480-53237502 TACCTACAAGGGATATATCAAGG + Intergenic
1118302803 14:64630367-64630389 ATACTACACCATTTATATCAGGG + Intergenic
1118485489 14:66210827-66210849 AAACTTCAAAAGATATAAGATGG - Intergenic
1120292001 14:82586992-82587014 GAGCTACAAGAAATATATCAAGG - Intergenic
1120521029 14:85528874-85528896 AAACTATAACATCTATCTCATGG + Intronic
1122597943 14:102906550-102906572 TAACTACGACAGATATTTGAAGG - Exonic
1124164081 15:27303666-27303688 AAACTACACAATATATTTCATGG + Intronic
1124653807 15:31491801-31491823 AAATTACAACAGACTTTTCATGG + Intronic
1125281555 15:38047316-38047338 AAACTACCTAAGATATATCTAGG + Intergenic
1126357059 15:47807728-47807750 AAACTACAACTGACAACTCAGGG - Intergenic
1127153244 15:56100533-56100555 AATCTACAATAGATTTATCTTGG - Intronic
1128132470 15:65238125-65238147 AAAATACAAAAAATTTATCAGGG + Intronic
1128321158 15:66695351-66695373 AAGCTAACCCAGATATATCAGGG - Intergenic
1135695341 16:24581399-24581421 TAACTACCACAGACATATCCTGG - Intergenic
1138359566 16:56416247-56416269 AATCTACAAGAGATAGAGCATGG + Intronic
1144420731 17:15095659-15095681 ATATTTCAGCAGATATATCATGG - Intergenic
1150588937 17:66544230-66544252 CAACTACAAAAGATTTCTCATGG + Intronic
1155124632 18:22860227-22860249 AAACTACAAAACATAAATGAAGG + Intronic
1155347484 18:24873063-24873085 AAACTTCAACAGATAAATTTTGG + Intergenic
1155534434 18:26802400-26802422 ACAGTACAATAGATATATCTGGG + Intergenic
1156582640 18:38395107-38395129 AAACTACAACAGACCAATCCAGG + Intergenic
1156998831 18:43499569-43499591 AAACTGCAACAGACAAATCCAGG + Intergenic
1157633049 18:49119785-49119807 AAAATACTATAGATATATCAAGG + Intronic
1158020027 18:52830975-52830997 AAACTACAATATAGATCTCAGGG + Intronic
1159416501 18:68155903-68155925 AAACTACAAATTATATATAATGG - Intergenic
1159850005 18:73516048-73516070 AAACTACAACAGCTTTGTCCAGG + Intergenic
1162227548 19:9236163-9236185 AAACTGCAACATATATTTTAGGG - Intergenic
1166589003 19:43978979-43979001 AAACAACAACAAATCTATCCAGG - Intronic
1166962218 19:46504477-46504499 AAACAAAAAGAGATAGATCATGG - Intronic
1202705163 1_KI270713v1_random:17375-17397 AAAATACAAAAAATATAGCAGGG - Intergenic
925010082 2:477868-477890 AAACATGAACAGATATTTCATGG + Intergenic
927191588 2:20520585-20520607 CAACTACCACAGAGATAGCAAGG + Intergenic
928529852 2:32179886-32179908 AATTTACAACAGATATATAGTGG - Intronic
930512725 2:52366224-52366246 ACACTACAATAGAAAGATCATGG - Intergenic
930744385 2:54866740-54866762 AAAGTACAACAGAAACATCTGGG - Intronic
931095547 2:58936727-58936749 AAATTATAAAAGATATATCAAGG + Intergenic
932205617 2:69878951-69878973 AAGTTACAGCAGATATATAAAGG - Exonic
932840606 2:75078822-75078844 AACCTACAAAAGATGGATCATGG - Intronic
933072269 2:77873788-77873810 AAAAAACAAAAAATATATCAGGG - Intergenic
933273760 2:80262079-80262101 AAACTAGAATAAATATATAAAGG + Intronic
933361267 2:81288403-81288425 AAATTACAACTGACATACCAAGG - Intergenic
933483478 2:82887735-82887757 AAACTTCACCAGATATATTTAGG + Intergenic
934306954 2:91833850-91833872 AATCTACTTCAGATATATAAAGG + Intergenic
934326302 2:92018892-92018914 AATCTACTTCAGATATATAAAGG - Intergenic
934506958 2:94902343-94902365 ATACTACTACAGATATCGCAGGG - Intergenic
936048447 2:109204420-109204442 AAACTACAGCAGATTTTTAAGGG - Intronic
937421656 2:121761713-121761735 ATACTACACCAGTTATATAAGGG - Intronic
937465459 2:122129110-122129132 AAAGAAAAAAAGATATATCATGG - Intergenic
937802584 2:126097400-126097422 AAACTACAACAGCCAAATCCAGG + Intergenic
938090523 2:128429030-128429052 AAACAACAACAAATGGATCATGG - Intergenic
939369087 2:141275134-141275156 AAACTACAACAAATACACAAGGG + Intronic
940004089 2:148995542-148995564 AAACTAGAACATATATATTATGG + Intronic
941330413 2:164172720-164172742 AAACTACAACAGCTCAATCCAGG - Intergenic
942907496 2:181201393-181201415 AAACTAAAACAGATAATTGAAGG + Intergenic
943000544 2:182323184-182323206 AAACAACTACATATATATAAAGG + Intronic
943145819 2:184043492-184043514 TAACTACAATAGATAAATTAGGG - Intergenic
943420550 2:187662613-187662635 TAACTTCAACAGAAACATCAAGG - Intergenic
943813970 2:192227650-192227672 AAACTTCAACTGATGTGTCAAGG - Intergenic
944482109 2:200168346-200168368 AAAATACATCAGGTATAACATGG - Intergenic
945438341 2:209846064-209846086 AAAAGACAACACATCTATCATGG - Intronic
945672295 2:212816805-212816827 AGACTTCAACATATAAATCAAGG + Intergenic
946628745 2:221643710-221643732 AAAATAAAACAAATATATCTTGG + Intergenic
946918015 2:224546647-224546669 AAAATACAACAGAAATAGGATGG + Intronic
948546646 2:238736321-238736343 AAATTAACACAGATAAATCAGGG - Intergenic
1173446127 20:43120188-43120210 AAACTATATCAAATATATAAAGG + Intronic
1174231748 20:49050986-49051008 ATAGTACAACAAATATATAACGG + Intronic
1176938545 21:14896216-14896238 GAATCACAACAGATATATCCAGG - Intergenic
1177267964 21:18808784-18808806 AAACTACAACAGCTCAATCCAGG + Intergenic
1177435121 21:21042055-21042077 AAACTATAACACATATACAAAGG + Intronic
1177519722 21:22203976-22203998 AAACTTCAACACAAATATCCAGG - Intergenic
1178449397 21:32681183-32681205 AAAGTAAAACAGATATACAAGGG + Intronic
1178708801 21:34896194-34896216 AAACTACAATAGATATTCTAAGG - Intronic
1178739053 21:35179810-35179832 AAAATACAACACAAATAACATGG + Intronic
1178792213 21:35710955-35710977 AAACAACAAGAGGTAAATCAGGG + Intronic
1183117301 22:35701875-35701897 AGATTACATCAGATATAACAAGG - Intergenic
1183813845 22:40281983-40282005 AAACTACAACAGAGCTATTGTGG - Intronic
949582617 3:5405201-5405223 AAGACACAACAGGTATATCATGG + Intergenic
950605561 3:14076423-14076445 AAACTACAAAAGAAATAGCGGGG - Intronic
951202591 3:19891556-19891578 AAAATATAACAGGTTTATCAAGG - Intronic
951450575 3:22833255-22833277 AAACTACAATAAATTTAGCATGG + Intergenic
952987416 3:38798603-38798625 AAACTAGAATAGATATTTCTTGG - Intergenic
953765062 3:45733620-45733642 AAAATGCAACAGATTCATCAAGG - Intronic
954865969 3:53730014-53730036 CAACTACAACATATATATTCAGG - Intronic
957387900 3:79520666-79520688 AAACTATAACAGAGATTACACGG + Intronic
957807064 3:85161715-85161737 AAAATACAATAGAAATTTCAAGG + Intronic
958021431 3:88001867-88001889 AAAATACAAAAGATACATGAAGG - Intergenic
958615186 3:96484578-96484600 AATCTACAACTAATATTTCAGGG + Intergenic
958687124 3:97413064-97413086 AAACTACAACAGAAATTTAGAGG - Intronic
959736705 3:109667267-109667289 AGACTCCCACAGAAATATCATGG + Intergenic
960393960 3:117113538-117113560 AAACAACAAAATATATAGCAAGG + Intronic
962729828 3:138271100-138271122 AAAACACAGCAGATATAGCATGG - Intronic
963283003 3:143405143-143405165 AAAGTTCAACAGATAAAACAGGG - Intronic
964290854 3:155178685-155178707 ATACTACACCATTTATATCAAGG - Intronic
965185111 3:165453186-165453208 AAACTACAAAAGATCTTTCAAGG + Intergenic
966790686 3:183666807-183666829 AAAATACAACAGTTGTACCAAGG + Intronic
972091330 4:35288500-35288522 AAACTGCAGAAGAGATATCAAGG + Intergenic
972246582 4:37251399-37251421 AAACTACCCCAGATCTTTCATGG + Intronic
972258250 4:37382196-37382218 AAACCACAGCAGAGATTTCAGGG + Intronic
972328630 4:38042553-38042575 AAATTAAAACACATATACCAAGG - Intronic
972999582 4:44929177-44929199 AAAATACAAAAGATATTTCAGGG + Intergenic
973075114 4:45915296-45915318 ACACTACAAGAGACATATCATGG + Intergenic
974343664 4:60649238-60649260 ATATTATAACAGATACATCATGG + Intergenic
974474176 4:62358657-62358679 AAATTACAACATATTTATTAAGG - Intergenic
975364275 4:73510469-73510491 AACCTACAACAAATACATCTAGG - Intergenic
975681478 4:76881065-76881087 AAACTACAATATATTAATCATGG + Intergenic
976062703 4:81148140-81148162 AAATGACAACAGATATCACAAGG - Intronic
976276671 4:83285255-83285277 AAACAACAACAGAGAAATAACGG + Intergenic
976486020 4:85606058-85606080 AAATTACAACATTTATGTCATGG + Intronic
977031933 4:91894006-91894028 AAACTACAACAGCCAAATCCAGG + Intergenic
977225844 4:94390794-94390816 AAACTAAAGCAGTTATTTCAAGG - Intergenic
977431015 4:96930039-96930061 AAACTACAACAGCTCAATCCAGG + Intergenic
977917315 4:102608630-102608652 AAAGTATATCAGATATGTCAGGG - Intronic
978975374 4:114863590-114863612 AAACTGCAACAGATATTTACTGG + Intronic
979544468 4:121924178-121924200 AAAATACATCAGATAGATGATGG - Intronic
980529359 4:134031177-134031199 AAACTATAACAGATATAAACAGG - Intergenic
980608751 4:135127918-135127940 GAACTACAAAATATTTATCAGGG - Intergenic
981178131 4:141706384-141706406 AAATTACAACAGCTACATAATGG - Intronic
981521690 4:145669159-145669181 AAACAACAACAGATACTTCACGG + Intergenic
982142411 4:152338987-152339009 AATTGACAACAGATATATTAAGG + Intronic
983874960 4:172864574-172864596 AAACTGAAATAGAGATATCATGG - Intronic
984373639 4:178899446-178899468 AAACTATTACAGATACATTAGGG + Intergenic
984681805 4:182619571-182619593 AAACTAAAACATATATAGGAAGG - Intronic
985284262 4:188319110-188319132 AAAATACAAAAGATAATTCAAGG + Intergenic
987138559 5:14922115-14922137 ACATTACAACAGAAATACCAAGG + Intergenic
987868911 5:23585932-23585954 AAAATACAATTAATATATCATGG + Intergenic
988096047 5:26611727-26611749 AAACTTCATGAGATACATCATGG - Intergenic
988168967 5:27631004-27631026 AAACTACAACAGCTCAATCCAGG - Intergenic
988785280 5:34561111-34561133 AAACTACAACAGCTCAATCCAGG - Intergenic
989201165 5:38765113-38765135 AAACAAGTACACATATATCATGG - Intergenic
989461577 5:41705528-41705550 GAATTACAACATATATACCAAGG - Intergenic
989461580 5:41705585-41705607 GAATTACAACATATATACCAAGG - Intergenic
989507790 5:42247346-42247368 AAACTAGAACATATATAAAAGGG - Intergenic
989632580 5:43501075-43501097 ATACTAAAGCAAATATATCATGG - Intronic
991508107 5:67346024-67346046 AAACTACAGCAGATATACAAAGG + Intergenic
993231662 5:85245704-85245726 AAACTACAACAGCTCAATCCAGG - Intergenic
995068234 5:107887005-107887027 ATACTAGAACAGACAAATCAGGG + Intronic
996074314 5:119172016-119172038 AAACTACAAGATAAATATTAAGG + Intronic
997334506 5:133096941-133096963 AAAGAACAATAGAAATATCAAGG - Intronic
1000499362 5:162029838-162029860 AAACTACAACAGCTCAATCCAGG + Intergenic
1001487379 5:172129187-172129209 AAACCACAGCAGATAAAACAGGG + Intronic
1002288883 5:178185783-178185805 AAGTTACAGCAGATATATAAAGG + Intergenic
1002977767 6:2101204-2101226 TAACTACAACAGAAACATCCCGG - Intronic
1003801620 6:9676142-9676164 AAATTTCCACAGATATATAAAGG - Intronic
1004910911 6:20282636-20282658 AAACTATTACAGAAAAATCAAGG + Intergenic
1005141922 6:22641927-22641949 AAACTACAATGTATATTTCATGG - Intergenic
1008300807 6:49836762-49836784 TAACTACAGTAGATTTATCAAGG + Intronic
1009297857 6:61976526-61976548 AAAATATAATAGAAATATCAAGG - Intronic
1010116723 6:72321217-72321239 AAACTACAACAGATATATCAAGG + Intronic
1010374666 6:75153028-75153050 TAACTACCACATATATATGAAGG + Intronic
1010570442 6:77467264-77467286 CAACCACAAGAGATATCTCACGG + Intergenic
1010794525 6:80104100-80104122 AAACTCAAACAGAGGTATCATGG - Intergenic
1011831398 6:91376059-91376081 AAATTAAAACAGATAAATCAAGG - Intergenic
1012205265 6:96453389-96453411 TGCCTACCACAGATATATCATGG - Intergenic
1013714915 6:112947779-112947801 AAACTCCCAGAGAAATATCAAGG - Intergenic
1014421265 6:121248497-121248519 AAAATACAAAAGATAAATGAAGG + Intronic
1014956976 6:127631978-127632000 AAACTAAAACAGTTTTATTATGG + Intergenic
1014971298 6:127818595-127818617 AAACTACAACATATATTATAAGG + Intronic
1015044835 6:128764483-128764505 AAACAACAACAAAAAAATCAGGG + Intergenic
1015364670 6:132384532-132384554 AAAATAAAACAGAGATAACAGGG + Intronic
1015556591 6:134468588-134468610 AAACGAGAACAAATAAATCAAGG + Intergenic
1018547302 6:164951887-164951909 AAGCTACAACTCAAATATCAGGG + Intergenic
1020616026 7:10463850-10463872 AAACCACAGAAAATATATCAAGG + Intergenic
1020710573 7:11599217-11599239 AAACTACAACAGCCAAATCCAGG + Intronic
1020986413 7:15140658-15140680 AAACTTCAACCCATATATTAAGG + Intergenic
1022871559 7:34485539-34485561 ATGTTACAACAGATATATGATGG - Intergenic
1024537745 7:50451970-50451992 AAATGAAAACAGTTATATCAAGG + Intronic
1024808168 7:53173851-53173873 AAACTACAACACATCGATGAAGG - Intergenic
1027014068 7:74768282-74768304 AGAGTACAACAGTTAAATCATGG + Intergenic
1027540990 7:79465229-79465251 TAAATAGAACAAATATATCATGG - Intergenic
1028008393 7:85608536-85608558 AAACTACCATAGTTATTTCAAGG + Intergenic
1028066350 7:86390063-86390085 AAATTATAACAGTCATATCAGGG - Intergenic
1028141983 7:87283862-87283884 AAACTACAACAGCTCAATCCAGG + Intergenic
1028238126 7:88384974-88384996 AAACTACAACAGCTCAATCCAGG + Intergenic
1029010403 7:97254892-97254914 TAAGTTCAACAGATCTATCATGG + Intergenic
1030973648 7:116093313-116093335 AAACGAGAACAAATATTTCAAGG + Intronic
1031736028 7:125362966-125362988 AAAATTTTACAGATATATCATGG - Intergenic
1031981913 7:128133330-128133352 AACCTACAACAGGTATATGGGGG + Intergenic
1032668449 7:134061880-134061902 AAATTACAGCAGATACATTAAGG + Intronic
1033719155 7:144038587-144038609 AAATTCCATCAGATATATCTTGG - Intergenic
1034713141 7:153214355-153214377 AACCTACATCAGAAATATCATGG - Intergenic
1035640377 8:1180516-1180538 AAATTACAACAGATAATCCATGG - Intergenic
1037330638 8:17740527-17740549 AAAGTAGAACAGAAAAATCAAGG - Intronic
1039038389 8:33383951-33383973 AAAAAAAAACAGATAAATCATGG + Intronic
1042849271 8:73199464-73199486 CAACTTCACCAGATATAACAAGG - Intergenic
1045865001 8:106854813-106854835 AAAATAGAAGAGAAATATCAGGG - Intergenic
1048371039 8:133776389-133776411 AATCTAAAACAGAGACATCAGGG + Intergenic
1048673940 8:136755621-136755643 AAACTAACTGAGATATATCATGG + Intergenic
1050098358 9:2091887-2091909 AAACTAAAGCAGGTATATAAAGG + Intronic
1050140906 9:2514689-2514711 CAACTTCAACAGATAGGTCAAGG + Intergenic
1050872294 9:10587964-10587986 AAAATACAGCTCATATATCAGGG + Intronic
1051352067 9:16206269-16206291 AAACTACAGCAGATCCATCCAGG + Intronic
1051725650 9:20086210-20086232 AAAGAACAACAGCAATATCAAGG - Intergenic
1052671606 9:31564601-31564623 AAACTACAAGAGAAAAAACACGG + Intergenic
1054898006 9:70335982-70336004 AATCTACAACAAATACAGCAAGG - Intronic
1055001055 9:71448877-71448899 ATACCTAAACAGATATATCAAGG + Intergenic
1055167507 9:73215084-73215106 AAACTACAGCAGAGATATCTAGG - Intergenic
1056947146 9:91007627-91007649 AAACTTAAACAGATACATGAAGG + Intergenic
1058921354 9:109618259-109618281 AAACTACAGAAGATAGAGCATGG - Intergenic
1059134219 9:111788541-111788563 AAACTACTACTGATATTACAAGG - Intronic
1060137562 9:121171994-121172016 AAAGGACACCAGAGATATCAAGG - Intronic
1188058826 X:25575343-25575365 AATCTAGAACAGAAATCTCAAGG + Intergenic
1188062859 X:25621947-25621969 AAACTACTCAAGATATATCAAGG - Intergenic
1188816594 X:34722546-34722568 AAATGAAAACAAATATATCAAGG + Intergenic
1189548361 X:42067506-42067528 AAACTATAAAACATATATTAGGG - Intergenic
1191685255 X:63883265-63883287 TAACTACAAGAAAAATATCAAGG + Intergenic
1191941018 X:66482048-66482070 AAACTACAACAGCTCAATCCAGG - Intergenic
1192291831 X:69805488-69805510 AAACTAAAAAAGATATATCTTGG - Intronic
1192978536 X:76313952-76313974 AAAATACAAAAGATAAATGAAGG - Intergenic
1193016929 X:76744650-76744672 AAACAACAACAAAAATATCCAGG + Intergenic
1194404306 X:93475935-93475957 AAACTACAAACCACATATCAAGG + Intergenic
1195067762 X:101253018-101253040 AAACTAAAACAGAGAGAGCAAGG + Intronic
1195894311 X:109730463-109730485 AAACAACAACAGTCAAATCAAGG - Intronic
1196391787 X:115214729-115214751 AAACAAAAACAGATATTGCAAGG + Intronic
1196642687 X:118081314-118081336 AAAGTACATCAGATATGTCAAGG + Intronic
1197002538 X:121454756-121454778 AAACTACAACAGCCAAATCCAGG + Intergenic
1197084000 X:122451851-122451873 AAACTACAACAGCCAAATCCAGG - Intergenic
1197390474 X:125857393-125857415 AACCTATAACAGATATATGTAGG + Intergenic
1198121637 X:133598572-133598594 AACCTCCCACAGATATGTCATGG + Intronic
1198539849 X:137626343-137626365 AAATGACAACAGATATGACATGG - Intergenic
1199386372 X:147227975-147227997 AATCACCAACAAATATATCAGGG + Intergenic
1200692251 Y:6318194-6318216 GAACTACAACATTTATAACATGG - Intergenic
1200713459 Y:6510749-6510771 GAACTACAACATTTATAACATGG + Intergenic
1201020470 Y:9651292-9651314 GAACTACAACATTTATAACATGG - Intergenic
1201043021 Y:9856533-9856555 GAACTACAACATTTATAACATGG + Intergenic
1201049920 Y:9922423-9922445 GAACTACAACATTTATAACATGG - Intergenic
1201155974 Y:11131685-11131707 ATACTACTCCAGATATTTCAGGG + Intergenic
1201639914 Y:16167566-16167588 TAAATACCACAGATAAATCATGG - Intergenic
1201662899 Y:16417759-16417781 TAAATACCACAGATAAATCATGG + Intergenic