ID: 1010118966

View in Genome Browser
Species Human (GRCh38)
Location 6:72351245-72351267
Sequence GTGCTGACCTAAAAATTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010118966_1010118969 16 Left 1010118966 6:72351245-72351267 CCATTAAATTTTTAGGTCAGCAC 0: 1
1: 0
2: 2
3: 10
4: 128
Right 1010118969 6:72351284-72351306 TCATTTCCACTGAACTTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010118966 Original CRISPR GTGCTGACCTAAAAATTTAA TGG (reversed) Intronic
902679814 1:18035203-18035225 CTGGAGACCTAAATATTTAAAGG - Intergenic
909088704 1:71198852-71198874 ATGGTGACCTAAGAATTTTATGG - Intergenic
909145319 1:71923088-71923110 GGGCTGAAATAAATATTTAATGG - Intronic
909601679 1:77467737-77467759 GTAAAGACCTAAAACTTTAAAGG - Intronic
911021424 1:93392149-93392171 TTACTCACGTAAAAATTTAATGG + Intergenic
911829237 1:102529827-102529849 GTTTTGACCTATAAATTTAGGGG + Intergenic
911890502 1:103362964-103362986 CTACTGACCTAGAAATTTCAGGG + Intergenic
914820063 1:151094652-151094674 GTGCTGGCTTAAGAAATTAATGG - Intronic
916117307 1:161497606-161497628 CTGCTGACATCAGAATTTAAGGG - Intergenic
920271857 1:204771255-204771277 GTGAAAACCTAAAAATTCAATGG + Intergenic
923392377 1:233525867-233525889 GTTCTTTCATAAAAATTTAAGGG - Intergenic
923895255 1:238262272-238262294 GTCCTGAAATAAAAATTTGAGGG + Intergenic
1063312402 10:4966293-4966315 GTGCTGAGCTCAAAAAGTAAAGG - Intronic
1068253785 10:54480325-54480347 GTGCACACCTAAAAACTCAATGG + Intronic
1072028560 10:91492080-91492102 GTGCTAAATTAAAAATTTGAAGG + Intronic
1077778567 11:5298849-5298871 ATGCTGACTTAATAATTGAAAGG + Intronic
1093983272 12:25498882-25498904 GTCCTGAGCAAAAAAATTAATGG + Intronic
1095711040 12:45288263-45288285 GTGCTGAACTATACACTTAATGG - Intronic
1096306113 12:50478092-50478114 GTCCAGCTCTAAAAATTTAAAGG + Exonic
1099309261 12:80997169-80997191 GTGCTTACCTAAGATTATAATGG + Intronic
1102202335 12:111066252-111066274 GAACTGACCTATATATTTAAAGG + Intronic
1102358435 12:112260993-112261015 GTGCTGACCTTGATAATTAAAGG + Intronic
1102939477 12:116926589-116926611 GTGCTTGCCTAAAAAAATAATGG - Intronic
1108279366 13:48846040-48846062 GAGCTGAGTTAAAAATTTCAAGG - Intergenic
1108788042 13:53930773-53930795 TTACTGAACTAAAAATTTCATGG + Intergenic
1109788309 13:67212389-67212411 GTACTGTGCTTAAAATTTAATGG + Intronic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1113297607 13:108977601-108977623 CTGCTGTGCTGAAAATTTAAAGG - Intronic
1115175941 14:30561707-30561729 CTGCAGACATAAAAATTAAAAGG - Intronic
1117068512 14:52034358-52034380 GGGCTGACCTGGACATTTAAAGG + Intronic
1120503802 14:85328714-85328736 GTGAAGACATAAAAATTCAATGG + Intergenic
1126143893 15:45459036-45459058 GTACTAACCTAATAATTCAAGGG - Intergenic
1127023243 15:54775007-54775029 CTGCTGACCTAAAAGTGTATGGG + Intergenic
1127587475 15:60392372-60392394 GTACCAACCTAATAATTTAAGGG + Intronic
1133099161 16:3468768-3468790 GTTCTAACTTAAAAATTCAAGGG + Intronic
1134144850 16:11752612-11752634 TTGCTGACCTCAAATTTTCATGG - Intronic
1139387365 16:66581363-66581385 GTGCTTACCTAAAAATACCAGGG + Intronic
1142791730 17:2271887-2271909 TTGCTGACTTAAAAAGTTGAAGG - Intronic
1142829186 17:2534960-2534982 GTTTTGACCAAAATATTTAAAGG + Intergenic
1143212705 17:5200845-5200867 TAGCTGATCTAAAACTTTAATGG + Intergenic
1147714862 17:42499163-42499185 GTGCTTTTCTAAAAATTTAATGG + Intronic
1149106854 17:52979131-52979153 ATGCTGTTGTAAAAATTTAAAGG - Intergenic
1150100388 17:62418150-62418172 ATTCTGATCTAAAAATGTAAGGG + Intergenic
1151916864 17:77124617-77124639 ATGTAGACCTAAATATTTAAAGG + Intronic
1153475353 18:5493190-5493212 TTGCTGACATAAAAATTCAGTGG + Intronic
1153500867 18:5748526-5748548 GTGTAGACCTAAACTTTTAAAGG + Intergenic
1155701968 18:28756977-28756999 GTGTTGATCTAAAAATTCATAGG - Intergenic
1159371786 18:67536935-67536957 GGGCTGCCCTTAAAATATAAAGG + Intergenic
1164190244 19:22909233-22909255 ATGTTGACCTTAAAATTTTAGGG + Intergenic
925789903 2:7473618-7473640 CTGCTGACCTGAGAATTTAGGGG + Intergenic
927368046 2:22321875-22321897 GTGCTCTGCTTAAAATTTAACGG - Intergenic
930233422 2:48865587-48865609 GTGCTGACCTTGAACTTTCAAGG + Intergenic
931533546 2:63245682-63245704 ATGATGAACTAAAAATTGAAGGG + Intronic
931781955 2:65586437-65586459 GTGCTAGCTTAAAAATTTCAAGG - Intergenic
933439225 2:82289414-82289436 GTGGTGAGCTCAAATTTTAAAGG + Intergenic
935647667 2:105353960-105353982 GTGCTGACTTAAAGACTTGAGGG + Intergenic
935877933 2:107532318-107532340 GTGTTTACCTAATATTTTAAAGG - Intergenic
937384108 2:121410683-121410705 GTGCAGAGGTAAAAGTTTAAGGG + Intronic
937596071 2:123675119-123675141 GTGCAGACCCTAAAATTTATGGG + Intergenic
939140558 2:138349249-138349271 GTGATGAACTGAAAATTGAAGGG + Intergenic
939156463 2:138530647-138530669 TTGCTAACATAAAAATATAATGG + Intronic
942826793 2:180187497-180187519 ATGATGAACTAAAAATGTAAGGG - Intergenic
1169738992 20:8869392-8869414 GTGCTGACATAAAAAGTTCAGGG + Intronic
1169809181 20:9592121-9592143 GTGATGACCTTAATATTTAATGG - Intronic
1170092930 20:12612136-12612158 GTGCTGACATAATAATTTATCGG - Intergenic
1171308389 20:24125667-24125689 GTGCTTACCTAAATATATATGGG + Intergenic
1174804852 20:53595626-53595648 GTGCTGGCCTAAGAATCTACTGG - Intronic
1176013455 20:62913446-62913468 ATGCTGACCTCAAAGATTAAGGG + Intronic
1178138186 21:29651935-29651957 ATGCTGCCCTAAAAATTCTAGGG + Intronic
1178214938 21:30584833-30584855 ATACTGACGTAAAAATTCAAAGG + Intergenic
1179645696 21:42774472-42774494 GAACTGACTTAAAAATTAAATGG - Intronic
1183535825 22:38400152-38400174 GTGCTGGCCTAAGAATCTACCGG - Intergenic
951134547 3:19089253-19089275 GTAGTGACATAAAAATTAAATGG + Intergenic
952166995 3:30760946-30760968 GTGCTGTTCTAAAAAATCAATGG + Intronic
963186733 3:142426834-142426856 TTGCTGACCTTAAAGGTTAAGGG + Exonic
963221004 3:142811903-142811925 GTGCTGTTTTAAAAATTTTAAGG + Intergenic
965389275 3:168084703-168084725 GTGCTGTCATAAAAATCTAAAGG + Intronic
965868913 3:173242476-173242498 GTGCTCAGTTATAAATTTAAAGG + Intergenic
966323997 3:178733777-178733799 ATGATCACTTAAAAATTTAAGGG - Intronic
967066150 3:185917976-185917998 GTGCTGTCCAAAAATTTTTAAGG + Intronic
967984411 3:195084609-195084631 GGGCTGACCTAAGTATTTTAGGG - Intronic
968379280 4:75481-75503 GTCATGACCTAATAACTTAAGGG + Intronic
968714006 4:2141178-2141200 CAGCTGACCTAAACAATTAAGGG - Intronic
971442309 4:26700364-26700386 GTGCTGAAATAAATATTGAATGG + Intronic
974553422 4:63410603-63410625 ATTCTGACAAAAAAATTTAATGG + Intergenic
974839451 4:67283921-67283943 ATGATGACTTAAAAATTTTAAGG + Intergenic
977403382 4:96563711-96563733 GTGCTGGGCTTAAAATTTAATGG - Intergenic
978026700 4:103885377-103885399 ATGTTGACCAAAAAATTTACTGG - Intergenic
978672950 4:111273349-111273371 GTGCTCATCTAAACATTTACAGG + Intergenic
978965415 4:114734943-114734965 GAGCTGACCTATATTTTTAAAGG + Intergenic
979041682 4:115806106-115806128 CTGCTGACCTAAAACTCTAGAGG + Intergenic
980402488 4:132309296-132309318 CTCCTGACCAAATAATTTAAAGG - Intergenic
983342759 4:166486222-166486244 GTTCTGAACTAAAAATTTAATGG + Intergenic
983438446 4:167748555-167748577 GTGCTAACCTAAAACTATCAAGG + Intergenic
984252661 4:177352938-177352960 CTGCTGACCTAAAGCTTTATGGG + Intronic
985870853 5:2555304-2555326 ATTCTGACCTGAAAATTTTATGG + Intergenic
986996458 5:13612636-13612658 GTGGTTTCCCAAAAATTTAAAGG + Intergenic
987321584 5:16775160-16775182 ATCCTGACCTAACACTTTAAGGG + Intronic
989033508 5:37144935-37144957 GTGCTGACTTAAAAAATAAAAGG + Intronic
990340796 5:54821134-54821156 GTGCTGAGCTAGAAATAAAAGGG + Intergenic
993254206 5:85566644-85566666 ATTCAGACCTAAAAATATAAGGG + Intergenic
993338706 5:86694303-86694325 ATGATGAACTAAAAATTGAAGGG - Intergenic
993361359 5:86980728-86980750 CTGCTGACCTATAAACTAAAAGG - Intergenic
993486694 5:88495785-88495807 GTGCAGAGGTAAAAATTAAATGG - Intergenic
993562683 5:89430624-89430646 GTGCTTACTTAAATATTGAAAGG + Intergenic
994180283 5:96756558-96756580 GTGCTGACCTGACAACTCAAAGG - Intronic
996315923 5:122160419-122160441 TTTCTAATCTAAAAATTTAAAGG + Intronic
996316895 5:122170263-122170285 GTGCAGACCTCAAAAGTTGAGGG + Intronic
998257277 5:140597859-140597881 ATGCTGAAATAAAGATTTAAAGG + Intergenic
999142753 5:149373430-149373452 GTGCATACATAAAAATTTCAGGG + Intronic
1004496263 6:16166001-16166023 GAGCTGCCCTAACAAATTAAGGG - Intergenic
1005588361 6:27299207-27299229 GTACTCACTTAAATATTTAAGGG - Intronic
1010118966 6:72351245-72351267 GTGCTGACCTAAAAATTTAATGG - Intronic
1012242192 6:96886077-96886099 GTGGTAACCTAAATATTTAAAGG + Intergenic
1013223438 6:108100807-108100829 CTCCTGACCTCAAAATTCAATGG - Intronic
1014921303 6:127216858-127216880 CTGATGACTTAAAAATTTAATGG - Intergenic
1015874869 6:137812762-137812784 GTGCTGATCTAAAATGTTAATGG - Intergenic
1017502361 6:155037469-155037491 ATGCTGACCTGCAACTTTAAGGG - Intronic
1020476885 7:8606510-8606532 CTGCTGAGCTAAAAACATAATGG + Intronic
1021341908 7:19475158-19475180 GTCATCACCTAAAAATTTCAAGG - Intergenic
1029914224 7:104189954-104189976 GTGCAGACCTCACAAGTTAAGGG - Intronic
1031386198 7:121154390-121154412 GTACTGAACAGAAAATTTAAAGG - Intronic
1031628620 7:124019706-124019728 GACCTGACCTAAAACTTTACTGG - Intergenic
1032029525 7:128470987-128471009 ATTCTGATCTAAAAATGTAAGGG + Intergenic
1038080329 8:24127649-24127671 ATGCTAACCTGAAAATTAAAGGG + Intergenic
1041565914 8:59278888-59278910 GTGATGAACCAATAATTTAAAGG - Intergenic
1044316733 8:90757871-90757893 TTGCTGTCCTAAAAAGATAATGG + Intronic
1045462329 8:102436301-102436323 GTGCTTACTTAAAAATTTAACGG + Intergenic
1050447079 9:5735767-5735789 CTGTTAACCTAAATATTTAAAGG + Intronic
1051230165 9:14947785-14947807 GTGTGGAGCAAAAAATTTAAGGG + Intergenic
1051655411 9:19376644-19376666 TTTCTTACCTAAAAATTCAAAGG + Exonic
1052099437 9:24426541-24426563 ATGCTGTCCTCAACATTTAAGGG - Intergenic
1055462879 9:76535942-76535964 GTGTTGAACTAAAACCTTAAAGG + Intergenic
1059591906 9:115670972-115670994 GTGCTTTCCTAAAAATAAAAGGG + Intergenic
1188250968 X:27893800-27893822 GTCCTGACTCAAACATTTAAAGG - Intergenic
1189509987 X:41652855-41652877 GAGCTGATCTAACAAATTAATGG + Intronic
1194004875 X:88478195-88478217 GTGTTGCCATAAAAATTAAATGG - Intergenic
1196640815 X:118058151-118058173 GGGCTGACATCAGAATTTAAAGG - Intronic
1196794138 X:119488911-119488933 GTGCTGTCCTGACAATTTGAAGG - Intergenic
1198798544 X:140425768-140425790 TGGCTAACCTAAAAATGTAAGGG - Intergenic
1200136325 X:153876592-153876614 GTACAGACCTAAAAAGCTAATGG + Intronic