ID: 1010120117

View in Genome Browser
Species Human (GRCh38)
Location 6:72365354-72365376
Sequence CAGAACTTGGAGTATTTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010120117_1010120120 3 Left 1010120117 6:72365354-72365376 CCAGATAAATACTCCAAGTTCTG 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1010120120 6:72365380-72365402 GGCAGATACATTGTTTACCAAGG 0: 1
1: 0
2: 0
3: 7
4: 127
1010120117_1010120121 13 Left 1010120117 6:72365354-72365376 CCAGATAAATACTCCAAGTTCTG 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1010120121 6:72365390-72365412 TTGTTTACCAAGGTACCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010120117 Original CRISPR CAGAACTTGGAGTATTTATC TGG (reversed) Intronic
900860676 1:5227053-5227075 CTGAAATTGGAGTCTTTTTCTGG - Intergenic
904445798 1:30572117-30572139 CAGAGCTTGGAGAGTGTATCCGG - Intergenic
908837373 1:68241423-68241445 AAGAACATGCAGTATTTATTTGG - Intergenic
908890193 1:68837722-68837744 ATGCACTTGGAATATTTATCTGG + Intergenic
909911072 1:81258597-81258619 CAGAACTTGCAGACTTTATGGGG + Intergenic
909988352 1:82190620-82190642 CAGAACTAGGATTTTTTATTAGG - Intergenic
911276055 1:95860195-95860217 CAGAACATAGAGTATTTTTAGGG - Intergenic
916628547 1:166586706-166586728 CAGAGCTTGAAATATTTATTTGG + Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919369519 1:196706137-196706159 CAGAACTTAGAGTCCTAATCAGG + Intronic
924660530 1:246012421-246012443 CAGAACTTGTAGCAATTCTCTGG + Intronic
1065627823 10:27649541-27649563 CAGAACTAGGAGATTTTATTTGG - Intergenic
1069159375 10:65073571-65073593 CAGAACCTGCAGTATCTGTCAGG + Intergenic
1072018448 10:91373734-91373756 CAAGACTTTGATTATTTATCTGG + Intergenic
1076520048 10:131075760-131075782 CTGAGCTTGGAGTATTAATCAGG - Intergenic
1080566988 11:33519143-33519165 CAGAATTCTGAGTATTTAACTGG - Intergenic
1081081549 11:38746660-38746682 CAGAACTTGAAATATTTTCCTGG + Intergenic
1081114961 11:39189186-39189208 TACAATTTGGAGTATTTTTCTGG - Intergenic
1082205634 11:49430612-49430634 AAAAACTTGGAGCATCTATCTGG + Intergenic
1086206549 11:84265029-84265051 TAGAACTTGGATTATCTGTCTGG + Intronic
1087298179 11:96401453-96401475 CAGAGCTTGGTGTAATTATTAGG - Intronic
1087548187 11:99611444-99611466 CAGTCCTTCTAGTATTTATCTGG + Intronic
1087916570 11:103818468-103818490 CAGAACTTGCTTTATTAATCTGG + Intergenic
1097577394 12:61412139-61412161 CAGAATATGGAGTATTTATAGGG - Intergenic
1099396072 12:82141188-82141210 CAAAATTTGGAGTATTTCACAGG + Intergenic
1099779736 12:87178342-87178364 CAGAACTTGGATAATCTATTTGG - Intergenic
1099876523 12:88413863-88413885 GTGAACTTAGAGTAGTTATCTGG + Intergenic
1101517015 12:105446220-105446242 CAGAAAATAGAGTATTAATCAGG + Intergenic
1107630310 13:42336032-42336054 GAGGACTTGGAGAATCTATCAGG - Intergenic
1115977138 14:39009195-39009217 CAGAACTTGAAATATTTTCCTGG - Intergenic
1117215339 14:53545761-53545783 CAGAACTTGCAATATTAATCAGG + Intergenic
1119794150 14:77380647-77380669 CAGTTCTTGGAATATTTATGGGG - Intronic
1120830199 14:88991242-88991264 CAGCACTTGGAGGATATGTCAGG - Intergenic
1124139716 15:27066805-27066827 TAGAACTTGAAGGATTTAACGGG - Intronic
1124723519 15:32133997-32134019 CAGAGCATGGAATATTTGTCAGG - Intronic
1129904208 15:79174734-79174756 CCGAACTTGAAGAAATTATCTGG + Intergenic
1130675534 15:85948789-85948811 GAGAACTTGGAGTATGTATAGGG - Intergenic
1130974341 15:88761810-88761832 AAGAACTTGGCTTATTTAACAGG - Intergenic
1131682966 15:94743199-94743221 GTGAACTTGGACTATGTATCAGG - Intergenic
1138323586 16:56140998-56141020 AAGAACCTGGAGAATTTTTCAGG + Intergenic
1144236525 17:13266405-13266427 AAGAAATTGGAGTATTTCTGGGG - Intergenic
1145990314 17:29075399-29075421 CAGATCTGGGAGTATTTGACAGG - Exonic
1149818098 17:59746930-59746952 AAGAACCTGTAGTATTCATCAGG + Intronic
1154014972 18:10607914-10607936 CACAACTGGGAGTATTTAGGAGG + Intergenic
1154190542 18:12227730-12227752 CACAACTGGGAGTATTTAGGAGG - Intergenic
1157788511 18:50508346-50508368 CAGAACATGCAGTTTTTAACTGG - Intergenic
1158739670 18:60125783-60125805 CAGAACTTGAAATATTTTCCTGG + Intergenic
1163742630 19:19025513-19025535 CAGGACTTGGAGTGTTTTTCTGG + Exonic
929285023 2:40126164-40126186 CAGAGCATGGAGTTGTTATCTGG - Intronic
929840557 2:45457662-45457684 CAGAACATGAAGTGTTTGTCGGG - Intronic
931609781 2:64086675-64086697 CAGAATTTGGAGGATTTCTTTGG + Intergenic
933608011 2:84404566-84404588 GAGAACTTGGAGTATCCAGCAGG - Intergenic
933644644 2:84800507-84800529 CAAACCTTGGATTATTTCTCTGG - Intronic
936949803 2:117966428-117966450 CAGAACTGGAAGTATTTAGTGGG - Intronic
937655795 2:124374276-124374298 CAGAACTTTGACTTTCTATCTGG - Intronic
938723602 2:134087650-134087672 CAAAACTTGGAGTAAGTACCTGG - Intergenic
940490909 2:154359311-154359333 TTGAACTTGGAGTATATATTTGG - Intronic
944080812 2:195786584-195786606 CAGAGCTTGGACCATTTGTCAGG - Intronic
945500825 2:210572487-210572509 CAGAATTTAGAGTATTTATAAGG + Intronic
945769593 2:214025097-214025119 TAGCACTGGGAGTATTTATTTGG + Intronic
945926731 2:215813077-215813099 CAGAACTGGTAGCATTAATCAGG + Intergenic
946919287 2:224561293-224561315 CAGAACTTGGAGATTTTATGTGG - Intronic
946947984 2:224842420-224842442 CAGAACTTAGAGAATTTTCCAGG - Intronic
1170210640 20:13843366-13843388 AAGAACTTGGAGTAATTTTCAGG + Intergenic
1173051392 20:39565546-39565568 CAGAGCATGGCATATTTATCAGG - Intergenic
1175469086 20:59213357-59213379 AAGGACTTTGAGAATTTATCTGG - Intronic
1179240966 21:39591828-39591850 GAGAACATGCAGTATCTATCTGG + Intronic
1183191192 22:36323003-36323025 CAGAAAGTGAAGCATTTATCAGG - Intronic
1183574178 22:38676608-38676630 CAGAACCTGAAGGATATATCTGG - Intergenic
949213684 3:1537781-1537803 CATAACTTTGACTATTTAGCAGG + Intergenic
951620513 3:24596723-24596745 CAGAATTTTGAGGATTCATCAGG + Intergenic
952409900 3:33038713-33038735 GAGAGCTTGAAGTATTTACCAGG - Intronic
952636051 3:35533343-35533365 CAAAGCTTGTAGTTTTTATCAGG - Intergenic
953467370 3:43134418-43134440 CAGAACTTGCATTACCTATCTGG - Intergenic
953725722 3:45396477-45396499 CAGAACGTGGTGTGTCTATCAGG + Intronic
959442253 3:106391629-106391651 CACAAATTGGAGTGATTATCTGG + Intergenic
960423110 3:117473557-117473579 CAACACTTGGAGGATTTTTCAGG + Intergenic
966964733 3:184979454-184979476 AAGAACTTGTATTATATATCTGG + Intronic
967099197 3:186201881-186201903 CAGGACTTGGCATATCTATCAGG - Intronic
970924573 4:21436133-21436155 CAGAACTTGGATTAGACATCAGG - Intronic
971061356 4:22975023-22975045 CAGCACATGGAATATTTTTCAGG - Intergenic
972876569 4:43368956-43368978 GAGAACTTGAAGTATAAATCTGG + Intergenic
972941310 4:44197905-44197927 CAGCTCTTGGATTATTTTTCTGG - Intronic
974544114 4:63277636-63277658 AAGAACTTGTTTTATTTATCTGG - Intergenic
974929611 4:68347062-68347084 CAGTACCTTGAGTATTTACCAGG - Intronic
976074156 4:81277602-81277624 CATTACTGGTAGTATTTATCTGG + Intergenic
976948338 4:90798366-90798388 CAGCACCTGCATTATTTATCAGG + Intronic
988888405 5:35585340-35585362 CAGAATTTGGAGTAGTAATTTGG + Intergenic
990217536 5:53550730-53550752 CAAAAGTTGGAGTATTTACTTGG + Intergenic
993725923 5:91366345-91366367 CTGAACTTGGTATATTTATCAGG - Intergenic
994071159 5:95604228-95604250 GAGTATTTGGAGTATTTAACGGG + Exonic
994691293 5:103022808-103022830 CAGAATTTGGATTATTCTTCAGG + Intronic
995833616 5:116379132-116379154 GAGAACCTGTAGTATTTATCTGG - Intronic
996776144 5:127134698-127134720 TAGACCCTGGATTATTTATCAGG + Intergenic
997084896 5:130785985-130786007 CAGGACTTGGTTTATGTATCTGG - Intergenic
997473951 5:134131993-134132015 TAAAACTTGGAGCATTTTTCAGG + Intronic
999628760 5:153547765-153547787 AAGAACCTGGAGTAATTAGCTGG + Intronic
1000311469 5:160049042-160049064 CAGGACTTGGAGTATAGACCAGG + Intronic
1000784979 5:165532097-165532119 CAGAAATTGGAGGATTTCACTGG - Intergenic
1001209103 5:169793797-169793819 CAGAACTTGGAGGAATGATGTGG - Intronic
1001853953 5:174994725-174994747 CAGAACTTGGAATATGTGTTTGG + Intergenic
1004475229 6:15965359-15965381 CAAAACTTGGTGTGTATATCTGG - Intergenic
1010120117 6:72365354-72365376 CAGAACTTGGAGTATTTATCTGG - Intronic
1011867595 6:91850229-91850251 CTGAACTTTGAGTATTTCTAGGG - Intergenic
1012011897 6:93799038-93799060 AAGAACTTGGATAATTTGTCAGG - Intergenic
1015249921 6:131116273-131116295 CAGTACTTGGAGGTTTTTTCAGG - Intergenic
1021717908 7:23476327-23476349 CAGGAATTGGAATTTTTATCTGG + Intergenic
1022168995 7:27804755-27804777 CAGATTTTGGATTTTTTATCAGG + Intronic
1023905092 7:44516305-44516327 CAGAACTGGGAGTATTTGGCCGG + Intronic
1024194051 7:47041584-47041606 TGGAACTTGAAGTATTTCTCTGG + Intergenic
1024194255 7:47043291-47043313 CAGAACTAGGAGAATTGCTCAGG - Intergenic
1024309466 7:47956229-47956251 CCGCACTTGGAGAATTTCTCTGG + Intronic
1031390522 7:121208283-121208305 CAGAGCTTGAGGAATTTATCTGG - Intronic
1032105760 7:129027849-129027871 AAGAGTTTGGAGTATTTACCAGG - Intronic
1039527275 8:38228048-38228070 CAGAACCTAAAGAATTTATCTGG + Intronic
1042545244 8:69945555-69945577 ATGAACTTAGAGTATTTTTCTGG + Intergenic
1042697491 8:71571483-71571505 CAGAACTTAAAGTATATATACGG + Intronic
1044602998 8:94024553-94024575 CAGAACTTGGACAGTTCATCAGG + Intergenic
1045895836 8:107215569-107215591 CAGAGCTTGTAGTAGTTAACTGG - Intergenic
1048790508 8:138099143-138099165 CATAACTTGGATTACTTTTCTGG + Intergenic
1048797024 8:138160058-138160080 CAGAATTCAGAGTGTTTATCGGG - Intronic
1049321884 8:142001069-142001091 CAGCATTTGGTTTATTTATCAGG + Intergenic
1058206320 9:102113642-102113664 CAGCTCTTGGAGTATTTTACTGG + Intergenic
1058548738 9:106089951-106089973 AAGAACTTGCTGTATATATCTGG + Intergenic
1061457753 9:130711756-130711778 CAGAACATGGATTATTTGTTAGG + Intergenic
1187010996 X:15279209-15279231 AAGAACCTAGATTATTTATCTGG - Intergenic
1188461747 X:30435150-30435172 CATCCCTTGGAGGATTTATCTGG + Intergenic
1194154306 X:90367507-90367529 AAGAACTTGGTTTATGTATCTGG + Intergenic
1196777770 X:119356040-119356062 AAGAATATGGAGTATTTCTCTGG - Intergenic
1197430390 X:126355605-126355627 AAAAACTTGGTGTATGTATCAGG + Intergenic
1199426615 X:147709234-147709256 TAGAACTTGGAGTAGATTTCTGG - Intergenic
1200500662 Y:3944400-3944422 AAGAACTTGGTTTATGTATCTGG + Intergenic
1201650997 Y:16286390-16286412 CAGAACATGCAGCATTTAACAGG - Intergenic
1201788192 Y:17808176-17808198 CAGGACTTGGATACTTTATCAGG + Intergenic
1201813361 Y:18097812-18097834 CAGGACTTGGATACTTTATCAGG - Intergenic