ID: 1010122900

View in Genome Browser
Species Human (GRCh38)
Location 6:72399750-72399772
Sequence CAACTCTGCTTGTGTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010122900 Original CRISPR CAACTCTGCTTGTGTAAAAC AGG Intronic
902452233 1:16504058-16504080 CCACTTTGTTTTTGTAAAACTGG + Intergenic
902500714 1:16909530-16909552 CCACTTTGTTTTTGTAAAACTGG - Intronic
907531370 1:55101154-55101176 AAACTCTGATTATGAAAAACTGG + Intronic
909864185 1:80645884-80645906 CAACTCTGCTTATGAGATACTGG + Intergenic
910112869 1:83701040-83701062 TAACTCTGCTTTTGTGACACTGG + Intergenic
912518287 1:110229214-110229236 CATCTCTGCTGGTGTAAAGGTGG + Intronic
914001598 1:143699266-143699288 CTACTTAGCTTGTGTTAAACAGG + Intergenic
914004337 1:143719355-143719377 CCACTTTGTTTTTGTAAAACTGG + Intergenic
914095567 1:144541724-144541746 CCACTTTGTTTTTGTAAAACTGG + Intergenic
914302954 1:146392170-146392192 CCACTTTGTTTTTGTAAAACTGG - Intergenic
915873248 1:159584814-159584836 CAACTCTGTTTGTGGCACACAGG + Intergenic
917214243 1:172661422-172661444 CCACTCTGCTTGTGTACATATGG - Intronic
917507176 1:175638234-175638256 CAACTCTGCTCTTGTTCAACTGG + Intronic
918275121 1:182946479-182946501 CAACTCTGCTTCTAGAACACAGG - Intronic
923516498 1:234702194-234702216 CAGCTGTGCTTGTGATAAACAGG + Intergenic
1066644623 10:37593650-37593672 CAACACTGCATGTTTAATACTGG - Intergenic
1067740168 10:48889521-48889543 CTATTCTGCTTTTGTATAACTGG + Intronic
1068929563 10:62575494-62575516 CACCTCTGCTGGTGTGACACAGG + Intronic
1070084196 10:73219525-73219547 CAAAACTGGTTGTGTGAAACTGG + Intronic
1076321460 10:129585181-129585203 GATATCTTCTTGTGTAAAACGGG + Intronic
1076598746 10:131643448-131643470 CAAGTCTGCTTATAAAAAACTGG + Intergenic
1079565096 11:21872697-21872719 CTACTCTGATTGTTGAAAACAGG + Intergenic
1083107527 11:60373074-60373096 CCACTCTATCTGTGTAAAACTGG - Intronic
1084233564 11:67770947-67770969 AAACCCTGGTTGTTTAAAACGGG + Intergenic
1085249736 11:75135073-75135095 CCAGTCTGCCTGTGGAAAACTGG - Intronic
1085453230 11:76650233-76650255 CTACTCTGCTCCTGTAAACCAGG + Intergenic
1090904732 11:131065367-131065389 CAACTCAGTGTGTGCAAAACTGG + Intergenic
1091527501 12:1317685-1317707 CAGCTCTGGTTGTGTGAAAGTGG - Intronic
1094325205 12:29230632-29230654 CATCTCTGCTTGTACCAAACTGG - Intronic
1097913263 12:64993426-64993448 CAAGTCTGATTGTGTAATAGAGG + Intergenic
1099988483 12:89697455-89697477 CACTTCTGCTTTTGTAAAAATGG + Intronic
1101543285 12:105684243-105684265 CAACAATGATTGTGTTAAACTGG + Intergenic
1101685200 12:107012349-107012371 CTACTCTGCCTGTGCAGAACAGG + Intronic
1102524796 12:113504711-113504733 CAACTCTCCTTATCTGAAACTGG + Intergenic
1105395895 13:20034172-20034194 TAACTTTGCTTCTGTAAAAGTGG + Intronic
1106322785 13:28658165-28658187 CAGATCTGCTTGTGCAAAAACGG - Intergenic
1106674168 13:31940111-31940133 AAACTCAGCATGTATAAAACTGG - Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1107874052 13:44773554-44773576 CAAATAAGCTTATGTAAAACTGG - Intergenic
1112160590 13:96863250-96863272 GAACACTGCTTGAGAAAAACTGG + Intergenic
1115662313 14:35508907-35508929 TAACTGTCCCTGTGTAAAACTGG + Intergenic
1115681186 14:35740130-35740152 TAACTCTGCTTGGGGAAATCAGG - Intronic
1122570779 14:102698572-102698594 AAGGTCTGCTTGTTTAAAACTGG - Intronic
1128229855 15:66026850-66026872 CACATCTGCATCTGTAAAACAGG + Intronic
1132899471 16:2245313-2245335 CAGCTCTGCTTGTGTGAGTCAGG - Intronic
1133390859 16:5408828-5408850 CAACTCTGACTGTTTAAAAGTGG - Intergenic
1135933777 16:26761767-26761789 CCACTCTGCCTCTATAAAACAGG + Intergenic
1140490522 16:75331765-75331787 CAAGCCTGATAGTGTAAAACTGG - Intronic
1140738071 16:77916410-77916432 CTTCTCCGCTTTTGTAAAACAGG + Intronic
1148044213 17:44732542-44732564 CATTTCTGCATTTGTAAAACAGG - Intronic
1149784922 17:59426520-59426542 CAACTCTGCCTTTTTAAAAGTGG + Intergenic
1149857479 17:60095582-60095604 CAACTCTGCTTTTGTGCAACTGG - Intergenic
1150419727 17:65021725-65021747 CAACTCTGCTTATAGAAAATAGG + Intronic
1151252824 17:72850556-72850578 CAACATTGCTTGTCTTAAACAGG - Intronic
1151741209 17:75983497-75983519 AAACACTGGTTGTCTAAAACAGG - Intronic
1156552204 18:38029447-38029469 CAATTCTGCTTGAGGAAATCAGG + Intergenic
1160770693 19:829413-829435 CGGCTCTGCTTCTGTAAAAGCGG + Intronic
1163532829 19:17860717-17860739 CACCTCTGCATCTGTAAACCGGG + Intronic
1164845069 19:31425184-31425206 TAATTCTGCTTTTGTGAAACGGG + Intergenic
1168725198 19:58577260-58577282 AAACTGTGCTTGTGAAAAACAGG - Intergenic
925643616 2:6011858-6011880 CAACTATGCTTTTGCAAAACAGG + Intergenic
928614277 2:33020956-33020978 CAACTCTGTGTGTGTAAACCAGG + Exonic
929273040 2:39995157-39995179 CAACTCTTCATTGGTAAAACGGG - Intergenic
931086375 2:58835262-58835284 CAAATCTGCCAGTGAAAAACTGG - Intergenic
935267412 2:101406776-101406798 CAAATCTGATTGTGGAAAAGGGG + Intronic
936481366 2:112888092-112888114 CAACTCTGCTGGTTTATAAAAGG - Intergenic
937115940 2:119405012-119405034 CAACTCTTCTTGAGTGAGACGGG - Intergenic
939468713 2:142591855-142591877 CAAATTTGTTTGTGTAAAAAAGG + Intergenic
939922371 2:148132289-148132311 CAAGTCTGCTATTGAAAAACAGG + Intronic
943699101 2:190971023-190971045 CAAATCTGCTCATGTGAAACGGG + Intronic
944536224 2:200713174-200713196 AAAAGCTGCTTTTGTAAAACTGG - Intergenic
947456780 2:230262163-230262185 CAACCCTCCTAGTGTAAATCAGG - Intronic
1169519353 20:6354516-6354538 CAACACAGTTTGTGTAAACCAGG - Intergenic
1169925756 20:10782375-10782397 CATCTCTGAGTGTGTAAAAGGGG - Intergenic
1171334010 20:24367066-24367088 TAGCTGTGCATGTGTAAAACCGG - Intergenic
1178712437 21:34930415-34930437 CAACTCTGATTGATTAGAACTGG + Intronic
1180610402 22:17092990-17093012 CAACACTGCATCTGTAAGACAGG - Intronic
1182534062 22:30986925-30986947 TAGCTCTATTTGTGTAAAACTGG - Intergenic
1182665173 22:31953125-31953147 CAAAGCTGCTTCTGTGAAACTGG - Intronic
1183675023 22:39294441-39294463 CAACTCTGCTTCTGAAATAGGGG - Intergenic
1184363278 22:44031486-44031508 AAACTCTGCTTCTGTAGAAAAGG + Intronic
952140632 3:30475178-30475200 CAACTCTGAGTGAGAAAAACTGG - Intergenic
952937495 3:38411761-38411783 CAACATTGCTTATGTAAAAATGG + Intronic
953151159 3:40326255-40326277 CAACACTGCCTGTGTCAAAAAGG - Intergenic
953285317 3:41600942-41600964 CAATTTTTCTTGTGTAAAATAGG - Intronic
957050861 3:75410868-75410890 AAACGCTGGTTGTCTAAAACGGG + Intergenic
961883146 3:130077303-130077325 AAACACTGATTGTCTAAAACGGG + Intergenic
962082795 3:132158287-132158309 CATTTCTTCTTGTGTAAAATGGG + Intronic
964857967 3:161167580-161167602 CAGCTTTGGTTGTGTAAAACTGG + Intronic
969361564 4:6667395-6667417 AAACTCTGCTTCTGTGTAACAGG + Intergenic
969821582 4:9724825-9724847 AAACGCTGGTTGTCTAAAACGGG - Intergenic
970839770 4:20453853-20453875 TACCTCTTCATGTGTAAAACGGG - Intronic
972097079 4:35361434-35361456 CAACTCTGCTAGAATAAACCAGG - Intergenic
974934681 4:68398252-68398274 AAACATTGATTGTGTAAAACAGG + Intergenic
978682552 4:111399399-111399421 CATCTCTACTTGGGTAAAATCGG - Intergenic
982627999 4:157792243-157792265 CAAATCTGCTTATATAAAAAAGG - Intergenic
983338617 4:166428438-166428460 AAACTCTGCTTGTGAAATATGGG - Intergenic
988335264 5:29899593-29899615 CAGCTCTGCTAGTGCAAAGCAGG + Intergenic
995759731 5:115550786-115550808 TAACTCTGCTTGAGCAAATCTGG + Intergenic
996951352 5:129129672-129129694 CAACTCTTCTTTTATAAAAGTGG + Intergenic
997661431 5:135592049-135592071 CAGCTCTGCTTGTGTTAGAGTGG + Intergenic
999248896 5:150169897-150169919 CAGCCCCGCTTGTGTGAAACTGG - Intronic
1000493388 5:161945339-161945361 TCCCTCTCCTTGTGTAAAACAGG + Intergenic
1000961783 5:167609254-167609276 CGACTCTACTTGTGTAATCCTGG - Intronic
1004437224 6:15607912-15607934 CATGGCTGCTTGTGAAAAACAGG - Intronic
1005300693 6:24467454-24467476 CATTTCTTCTTATGTAAAACGGG - Intronic
1010122900 6:72399750-72399772 CAACTCTGCTTGTGTAAAACAGG + Intronic
1013924811 6:115458727-115458749 AAACTATGCTTGTGTTAAGCAGG - Intergenic
1014617353 6:123619578-123619600 CAAGTCTGTTTGTGTTTAACGGG + Intronic
1014870539 6:126590730-126590752 AAAATCTACTTGTGTAAAATTGG - Intergenic
1017299699 6:152842301-152842323 TAACTCTGATAGGGTAAAACTGG + Intergenic
1017766466 6:157610962-157610984 CAAATATGCTCGTGTAAGACTGG + Intronic
1018549965 6:164984444-164984466 CAACTCTGATACTGTAATACAGG - Intergenic
1019626693 7:2019488-2019510 CCACCCTCCTTGTGCAAAACGGG + Intronic
1020317168 7:6914035-6914057 AAACGCTGGTTGTCTAAAACGGG + Intergenic
1027799599 7:82734874-82734896 TAACTCTGCTTATGTAATCCAGG - Intergenic
1028529382 7:91821661-91821683 CAACTCTCCTTGGTTAAACCAGG - Intronic
1028863885 7:95685419-95685441 CAAATCTGATTGTGGAAACCTGG - Intergenic
1029303102 7:99599870-99599892 CATCTCTGCTTCTGTACAAAAGG + Intronic
1030611726 7:111697342-111697364 CTACTCTGCTTGTGTTTACCTGG - Intergenic
1030822420 7:114111682-114111704 CAATTGTCATTGTGTAAAACAGG + Intronic
1031733331 7:125325395-125325417 CATCTCTGCTGGTGTGAAAGAGG + Intergenic
1031822189 7:126517135-126517157 GTACTCTTCTGGTGTAAAACTGG - Intronic
1034010821 7:147527746-147527768 CAACTTTGCTTTTGTAAAAAGGG - Intronic
1036061484 8:5326647-5326669 CATCTCTGCTTGATAAAAACTGG - Intergenic
1036211448 8:6844252-6844274 CAACCCTGTCTCTGTAAAACAGG - Intergenic
1036511046 8:9400686-9400708 CAAGTATGTCTGTGTAAAACTGG - Intergenic
1037158743 8:15740492-15740514 CAACTGTGCTTTTGGAAAAACGG + Intronic
1038131952 8:24742314-24742336 TCACTCTGATTATGTAAAACAGG - Intergenic
1040784329 8:51147974-51147996 GAACTCTTCTTGGGTAAAAAGGG - Intergenic
1043751292 8:83938880-83938902 CAATTATGCTTCTATAAAACTGG + Intergenic
1043876804 8:85494593-85494615 CAAGTCTCCGTTTGTAAAACGGG - Intergenic
1043913397 8:85891232-85891254 GGACTCTGCTTGTTTAAAAAAGG + Intergenic
1046080441 8:109363822-109363844 CCACGCTGCTTGTGTCACACTGG - Intronic
1046692851 8:117305144-117305166 AAATTCTGTTTCTGTAAAACTGG - Intergenic
1046960824 8:120110981-120111003 CACTTCTGCTTCTCTAAAACAGG + Intronic
1050183435 9:2944888-2944910 TATCTCTGCTTGTGTAAACTTGG + Intergenic
1051098766 9:13497148-13497170 AAACTATGCTAGTGAAAAACTGG + Intergenic
1051722888 9:20056955-20056977 TAACTCTTCTTGGGTAATACTGG + Intergenic
1054951989 9:70862726-70862748 CAACCCTTCTTCTATAAAACAGG - Intronic
1058883943 9:109308720-109308742 CAACTCTATTTTTTTAAAACTGG + Intronic
1059656061 9:116358526-116358548 CATGTCTGGTTGTATAAAACAGG - Intronic
1188630192 X:32347468-32347490 CAACTCAGCTTGTGGAAAGACGG - Intronic
1189203892 X:39221322-39221344 CAGAGCTGCTTGTGAAAAACTGG + Intergenic
1194510356 X:94786412-94786434 CAACTCTCCTAGTTTAAACCAGG + Intergenic
1194934705 X:99934752-99934774 CAACTCTGCTAGATTAAATCGGG - Intergenic
1195351576 X:104001390-104001412 CAACTTTTCTTGTGTAAAACTGG - Intergenic
1196171822 X:112596733-112596755 CAACTCTGCTAGCTTAAATCAGG + Intergenic
1196783287 X:119401126-119401148 CAATTCTGCATCTGTAAAACAGG - Intronic
1197488812 X:127090230-127090252 CACCTCTGCTTGTGGAAAATGGG - Intergenic
1199902710 X:152192856-152192878 CAACTCTGCTACTGTATAACTGG + Intronic