ID: 1010124317

View in Genome Browser
Species Human (GRCh38)
Location 6:72414442-72414464
Sequence TTATGACTATGAAAGATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010124315_1010124317 7 Left 1010124315 6:72414412-72414434 CCTGACTTAGACATCAGTTGGGT No data
Right 1010124317 6:72414442-72414464 TTATGACTATGAAAGATCAATGG No data
1010124312_1010124317 21 Left 1010124312 6:72414398-72414420 CCTCAGGAGCAGTGCCTGACTTA No data
Right 1010124317 6:72414442-72414464 TTATGACTATGAAAGATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010124317 Original CRISPR TTATGACTATGAAAGATCAA TGG Intergenic
No off target data available for this crispr