ID: 1010138780

View in Genome Browser
Species Human (GRCh38)
Location 6:72587872-72587894
Sequence GTAGTTATAAAAGGGCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010138780_1010138788 13 Left 1010138780 6:72587872-72587894 CCATTTTGCCCTTTTATAACTAC No data
Right 1010138788 6:72587908-72587930 CTACAGTCTCCTGGCTCTAAGGG No data
1010138780_1010138784 4 Left 1010138780 6:72587872-72587894 CCATTTTGCCCTTTTATAACTAC No data
Right 1010138784 6:72587899-72587921 ATCTCCCTACTACAGTCTCCTGG No data
1010138780_1010138789 14 Left 1010138780 6:72587872-72587894 CCATTTTGCCCTTTTATAACTAC No data
Right 1010138789 6:72587909-72587931 TACAGTCTCCTGGCTCTAAGGGG No data
1010138780_1010138787 12 Left 1010138780 6:72587872-72587894 CCATTTTGCCCTTTTATAACTAC No data
Right 1010138787 6:72587907-72587929 ACTACAGTCTCCTGGCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010138780 Original CRISPR GTAGTTATAAAAGGGCAAAA TGG (reversed) Intergenic
No off target data available for this crispr