ID: 1010139923

View in Genome Browser
Species Human (GRCh38)
Location 6:72602323-72602345
Sequence TTCTATGTGAGAAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010139923_1010139926 6 Left 1010139923 6:72602323-72602345 CCCTCCACTTTTCTCACATAGAA No data
Right 1010139926 6:72602352-72602374 AACCCCATAGCAACCATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010139923 Original CRISPR TTCTATGTGAGAAAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr