ID: 1010141494

View in Genome Browser
Species Human (GRCh38)
Location 6:72620129-72620151
Sequence TCCCTATGGAGTTTCTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010141494_1010141502 28 Left 1010141494 6:72620129-72620151 CCTGCACAGAAACTCCATAGGGA No data
Right 1010141502 6:72620180-72620202 CGCCCCCTCCGCCTTCAGTCAGG No data
1010141494_1010141503 29 Left 1010141494 6:72620129-72620151 CCTGCACAGAAACTCCATAGGGA No data
Right 1010141503 6:72620181-72620203 GCCCCCTCCGCCTTCAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010141494 Original CRISPR TCCCTATGGAGTTTCTGTGC AGG (reversed) Intergenic
No off target data available for this crispr