ID: 1010142523

View in Genome Browser
Species Human (GRCh38)
Location 6:72627645-72627667
Sequence GGAGTCTAACCTACACTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010142523_1010142529 13 Left 1010142523 6:72627645-72627667 CCCAGTAGTGTAGGTTAGACTCC 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1010142529 6:72627681-72627703 GAGTTCACACAAGACCCTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 136
1010142523_1010142528 12 Left 1010142523 6:72627645-72627667 CCCAGTAGTGTAGGTTAGACTCC 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1010142528 6:72627680-72627702 AGAGTTCACACAAGACCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010142523 Original CRISPR GGAGTCTAACCTACACTACT GGG (reversed) Intronic