ID: 1010144650

View in Genome Browser
Species Human (GRCh38)
Location 6:72653000-72653022
Sequence TGTGATTGTCTGTGAATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 361}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010144650_1010144652 4 Left 1010144650 6:72653000-72653022 CCATTTATTCACAGACAATCACA 0: 1
1: 0
2: 3
3: 23
4: 361
Right 1010144652 6:72653027-72653049 TTCAGAGATTGTAAGAATTATGG 0: 1
1: 0
2: 2
3: 27
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010144650 Original CRISPR TGTGATTGTCTGTGAATAAA TGG (reversed) Intronic
900749625 1:4387168-4387190 TGTGATTTTCTTTGGAAAAAGGG - Intergenic
900833995 1:4985935-4985957 TAGGACTGTCTGTTAATAAATGG - Intergenic
901233528 1:7654626-7654648 TGTGCTTGTGTGTGTATAGATGG - Intronic
901233563 1:7654918-7654940 TGTGCTTGTGTGTGTATAGATGG - Intronic
906126039 1:43427516-43427538 GGGCATTGTCTGTGAAGAAAAGG - Exonic
908588555 1:65603343-65603365 TGTGTGTGTGTGTGAATAAATGG - Intronic
908921719 1:69202384-69202406 TGTGAGTGTTTGTTAATACAAGG + Intergenic
909264466 1:73538617-73538639 TGAGATTATCTGTGAAGAATTGG + Intergenic
909310563 1:74141975-74141997 TGTGTGTGTGTGTGTATAAATGG - Intronic
912406638 1:109444225-109444247 TGTAATTGGTTCTGAATAAAAGG + Intergenic
915162160 1:153928320-153928342 TGTTATTGTTTGTGAACAAAGGG + Intergenic
916412600 1:164560235-164560257 TGTGTGTGTGTGTGAATATAGGG + Intronic
916900953 1:169222706-169222728 TGTCATTGTCTGTGAAGTCAAGG - Intronic
918698758 1:187580406-187580428 TGTGTTTGTTTGTGAAGACAGGG - Intergenic
919249286 1:195031193-195031215 TGTGTGTGTGTGTGTATAAAGGG + Intergenic
919500013 1:198326578-198326600 GCTGAATGTCTGTGAATAATAGG + Intergenic
919554105 1:199030102-199030124 TGTGTATGTCTGTGAAGAAGGGG + Intergenic
920201750 1:204263753-204263775 TGTGTGTGTCTGTGTATAACAGG + Intronic
920251487 1:204625035-204625057 TCTGGTTGTGTGTGATTAAATGG - Intronic
921545821 1:216473787-216473809 TGTGCTTCTCTGGGAAGAAAAGG - Intergenic
921922494 1:220685358-220685380 TGTGATTGTATTTGAAGATAGGG + Intergenic
923315710 1:232778202-232778224 TGTGATTTTCTGTTGATATAAGG - Intergenic
923449890 1:234106655-234106677 TGTGAATGTGTTTGAAGAAAGGG - Intronic
924520302 1:244800501-244800523 TGTAATTGTCAGTGGATTAATGG + Intergenic
1064635897 10:17366710-17366732 TGTGATTGTAGGTGAAGACAAGG + Intronic
1064834268 10:19507790-19507812 TGAAAATGTATGTGAATAAATGG + Intronic
1065135788 10:22668330-22668352 GGTGATAGTCTGTGATGAAAAGG - Intronic
1066039156 10:31528053-31528075 TGTGATTGTGTTTGAATATGTGG + Exonic
1066689943 10:38016093-38016115 TATTATTGTCTCTGAATTAAAGG + Intronic
1067002772 10:42633192-42633214 TATTATTGTCTTTGAATTAAAGG - Intronic
1068151475 10:53137968-53137990 TGTGATTGTTTTTGAGCAAATGG - Intergenic
1070872510 10:79769065-79769087 TGTGATTGTATCTGAAGATAGGG - Intergenic
1070889907 10:79935446-79935468 TGTTTTTTTCTCTGAATAAAGGG - Intergenic
1071155746 10:82686918-82686940 TGTAAATGTCAGTGAATAACGGG + Intronic
1071412050 10:85406679-85406701 AGTGATTGTGTGTGTGTAAAAGG + Intergenic
1071639431 10:87291217-87291239 TGTGATTGTATCTGAAGATAGGG - Intergenic
1071655806 10:87446732-87446754 TGTGATTGTATGTGAAGATAGGG + Intergenic
1071893482 10:90038683-90038705 AGTTATTGTCTGTGACAAAAAGG + Intergenic
1073281815 10:102360065-102360087 AGTGATTCTCTTTGAAGAAAAGG - Intronic
1073854676 10:107660837-107660859 TGTGTGTGTATGTGTATAAAGGG - Intergenic
1074334445 10:112556091-112556113 TTTGCTTTTCTGTGTATAAATGG + Intronic
1076089169 10:127665034-127665056 TGTGAATGTCTATGAGTACATGG + Intergenic
1076433038 10:130420586-130420608 TGTGTCTGTCTGTGTATACATGG + Intergenic
1076611645 10:131729667-131729689 TAGGATTGTCTGTGGATAACAGG - Intergenic
1077847431 11:6040553-6040575 TGTGTGTGTGTGTGTATAAATGG + Intergenic
1077926676 11:6688092-6688114 TGTGTGTGTGTGTGTATAAATGG + Intergenic
1079004436 11:16782063-16782085 TGTGTGTGTCTGTGTATAAAAGG - Intronic
1079285159 11:19123001-19123023 TGTGATTATATATGATTAAATGG - Intronic
1079855334 11:25595737-25595759 TATGGTTGTCTGTTGATAAAAGG - Intergenic
1081088856 11:38836124-38836146 TGTGCTTTTCTGTATATAAAAGG + Intergenic
1082045137 11:47719601-47719623 TGTGTGTGTGTGTGTATAAAAGG + Intronic
1082224175 11:49682454-49682476 GGTGTTTGTTTATGAATAAATGG + Intergenic
1084695030 11:70747926-70747948 TGTGAATGTGTGTGTATACATGG + Intronic
1086624873 11:88936740-88936762 GGTGTTTGTTTATGAATAAATGG - Intronic
1086972261 11:93095813-93095835 TGTGTGTGTGTGTGAAGAAAGGG - Intergenic
1087218526 11:95520796-95520818 TTTAACTGTGTGTGAATAAAGGG + Intergenic
1087984235 11:104657753-104657775 TGTGTGTGTGTGTGTATAAATGG - Intergenic
1088765805 11:112975655-112975677 TGTGATTTTCTTTGAAGATAAGG + Intronic
1089756963 11:120694420-120694442 TGTGATTTTATTTGAACAAAAGG - Intronic
1091098677 11:132848980-132849002 TGTGATTGTGTGTGAAGCCAAGG - Intronic
1091189710 11:133680930-133680952 TGTGTGTGTGTGTGTATAAAGGG - Intergenic
1091715273 12:2772251-2772273 TGTGATGGTCTGTGACCCAAAGG - Intergenic
1094086235 12:26595201-26595223 TGTGTTTGTCTGTTATTAAATGG - Intronic
1094132622 12:27090824-27090846 TATGACTGTCTGTGTATAGATGG + Intergenic
1094354386 12:29562725-29562747 TGACCTTCTCTGTGAATAAATGG + Intronic
1096537838 12:52286779-52286801 TGTGAATGTCTGTGAGTATTTGG - Exonic
1096597028 12:52702422-52702444 TGTGTGTGTGTGTGTATAAATGG + Intronic
1096779483 12:53983958-53983980 TGTGGTTGTTTTTAAATAAAAGG - Intergenic
1096786242 12:54018690-54018712 TGTGAATTTCTGTTTATAAACGG + Intronic
1097482250 12:60143301-60143323 TCTAATTAACTGTGAATAAAAGG - Intergenic
1097627466 12:62018376-62018398 CTTGATTTTGTGTGAATAAATGG - Intronic
1098416374 12:70239901-70239923 CGTGATTGACAGAGAATAAATGG + Intergenic
1098538508 12:71623264-71623286 TGTGATTCTCTGTAATTAAGTGG - Intronic
1099159448 12:79223103-79223125 AGTGACTGACTGTAAATAAATGG - Intronic
1099328252 12:81247031-81247053 TGTGATTTTTTTTGAGTAAAAGG + Intronic
1099808651 12:87552348-87552370 TGTGATTATATCTGAATAAATGG - Intergenic
1100287128 12:93177585-93177607 TGTGACTGTCTTTGAATATGGGG - Intergenic
1100906210 12:99302654-99302676 TGAGAAAGTCAGTGAATAAAGGG - Intronic
1101157322 12:101940171-101940193 TGTGATTTTCTATCTATAAAGGG - Intronic
1101825869 12:108219567-108219589 TGTGTGTGTCTGTGCATTAATGG - Intronic
1102482168 12:113231476-113231498 TGTGACTGTCTTTGGAGAAAGGG - Intronic
1104129371 12:125878194-125878216 TGTGAGTGACTGTCAATAATTGG + Intergenic
1105249637 13:18686305-18686327 TCTTATAGTCTGTGAGTAAATGG + Intergenic
1105617453 13:22031923-22031945 TGTGAGGAACTGTGAATAAAGGG + Intergenic
1106143122 13:27027509-27027531 TGTCATTGTCTTTGAATTCAGGG - Intergenic
1106466225 13:30016680-30016702 AGTGTGTGTCTGTGTATAAAAGG - Intergenic
1106772975 13:32980626-32980648 TGTGTGTGTCTGTGTATATAAGG + Intergenic
1106872819 13:34039920-34039942 TGTGTTTGTCTGTGAGTAAAAGG - Intergenic
1106911561 13:34468675-34468697 TATGACTGTGTGTGAATTAAAGG - Intergenic
1106950899 13:34882576-34882598 TGTGTGTTTCTGTGTATAAATGG - Intergenic
1107745305 13:43499497-43499519 TGTCAGTGTCTGTGAGTAAGTGG - Intronic
1109665198 13:65525620-65525642 TTTGAATGTCTCTGAATAAAAGG - Intergenic
1110012088 13:70349407-70349429 TCTGATTGACTGTGAAGGAAGGG + Intergenic
1111268656 13:85852634-85852656 GGTGATTGTCTTTGAATTACAGG - Intergenic
1113287322 13:108866163-108866185 AATGAATGTCTGTGAAAAAAGGG - Exonic
1113398320 13:109969180-109969202 TTTGATTGACAGTGATTAAAAGG + Intergenic
1113935446 13:113991935-113991957 TGTGAGTGTGTGTGAATGTATGG - Intronic
1114864315 14:26569702-26569724 TGTGATTATTTGTCAATAATGGG - Intronic
1116232618 14:42236157-42236179 TGTGACTGTATTTGAAGAAAGGG - Intergenic
1116421326 14:44736173-44736195 TGTGACTGTATTTGAAGAAAGGG - Intergenic
1116861302 14:49997751-49997773 TGTGTGTGTATGTAAATAAAAGG - Intronic
1118271823 14:64350592-64350614 TGTGTGTGTGTGTGTATAAAGGG + Intergenic
1119970955 14:78969842-78969864 TGTGTGTGTGTGTGTATAAAGGG + Intronic
1120416681 14:84227989-84228011 TGTGATTGTGTTTGGAGAAAGGG - Intergenic
1121140177 14:91534812-91534834 TGTGGTTGCCTCTGAAGAAAGGG + Intergenic
1121843961 14:97156999-97157021 AGTGATTGTGTGTGAATCATGGG + Intergenic
1121867987 14:97380404-97380426 TGTAATTGTCTCTCAATAAATGG - Intergenic
1126391973 15:48167501-48167523 TTTGATTGTTGGTGAATAATAGG - Intronic
1127596697 15:60490226-60490248 TGGTATTGTCTAGGAATAAAAGG + Intronic
1128033433 15:64501803-64501825 AGTGATAGTCTGTGGATGAAAGG + Intronic
1128471054 15:67953732-67953754 TGTTACTTTCTGTGAATGAAAGG - Intergenic
1128521385 15:68377195-68377217 TGTGATTCTTTGTGTATTAAAGG + Intronic
1130757155 15:86776708-86776730 TTTTATTCTCTGTGAATCAATGG + Intronic
1131702897 15:94958816-94958838 AGTGTTTATCTGGGAATAAAAGG + Intergenic
1131897656 15:97051418-97051440 TTTGCTTCTTTGTGAATAAAGGG + Intergenic
1132322503 15:100936342-100936364 TGTGTGTGTCTGTAAATACATGG + Intronic
1133576059 16:7091297-7091319 AGTTATTTTCAGTGAATAAATGG - Intronic
1133638924 16:7698201-7698223 TGTGTGTGTGTGTGTATAAAGGG + Intronic
1133983743 16:10652434-10652456 TGTGTTTGCCTGTGTATATAAGG - Intronic
1133983780 16:10652748-10652770 TGTGTTTGCCTGTGTATATAAGG - Intronic
1134375202 16:13665784-13665806 TTTGATTATATGTGATTAAAGGG - Intergenic
1134395333 16:13857483-13857505 TGTGTGTGTGTGTGTATAAAGGG - Intergenic
1135608440 16:23843378-23843400 CGGGCTTCTCTGTGAATAAAAGG + Intronic
1138258407 16:55592332-55592354 TGTGCTTGTCTGTGAAGACAGGG - Intergenic
1139314249 16:66054880-66054902 TGTGTTTGTGTGTGTATAGATGG - Intergenic
1141845634 16:86606785-86606807 CCTGATTGTCAGAGAATAAATGG + Intergenic
1144237624 17:13277386-13277408 CGTGTTTGTCAGTGAATGAAAGG + Intergenic
1146236311 17:31167132-31167154 TGTGGTTGTTTGTGAAAAATGGG - Intronic
1146786090 17:35722583-35722605 TGAGACTATCTTTGAATAAAAGG - Intronic
1149097035 17:52855682-52855704 TGTGATTGACTTGAAATAAATGG - Intergenic
1149227191 17:54486827-54486849 TGTGATGGTATTTGAATATAAGG - Intergenic
1149724142 17:58875679-58875701 TGTGATTGTCTGTGAATCACAGG - Intronic
1150565416 17:66334853-66334875 TGTGTTTGTCAGTGGATGAATGG + Intronic
1153578510 18:6547699-6547721 TGTGAGAGCCTGTAAATAAAAGG - Intronic
1154439196 18:14372586-14372608 TCTTATAGTCTGTGAGTAAATGG - Intergenic
1155387634 18:25297117-25297139 TGTGTGTGTGTGTGTATAAAGGG - Intronic
1155865433 18:30959439-30959461 TGTGTTTGTGTGTGTAAAAAAGG + Intergenic
1156249567 18:35339653-35339675 TGTTAATGTCTAGGAATAAAAGG + Intronic
1156973605 18:43189191-43189213 TGTGTGTGTGTGTGAATATATGG + Intergenic
1157150912 18:45216823-45216845 TTTGATTCTCTGAGAATCAAAGG - Intronic
1159078830 18:63712461-63712483 GGTGTTTGCCTCTGAATAAAAGG - Intronic
1159188786 18:65015137-65015159 TGTAATTGTGTGGGAAAAAAAGG - Intergenic
1159376670 18:67602470-67602492 TGTGTTTGTGTGTGAAGCAAAGG + Intergenic
1159512231 18:69410215-69410237 AGTGATTGTTTTTTAATAAAGGG - Intronic
1160020521 18:75177167-75177189 TGTGATTGTATTTGAAGATAGGG + Intergenic
1160523038 18:79519866-79519888 TGTGCTTGGCTGTGACTAACAGG - Intronic
1161476298 19:4487614-4487636 TGGAATTGTCTGTGTTTAAATGG + Intronic
1162270138 19:9607752-9607774 TGTGATTGTCTATGTGGAAACGG + Exonic
1162270146 19:9607848-9607870 TGTGACTGTATGTGAAAATAGGG + Exonic
1162648752 19:12069006-12069028 TGAGATTCTCTCAGAATAAAGGG - Intronic
1163373757 19:16917218-16917240 TGTGTTTGTTTATGAATAACAGG - Intronic
1163872396 19:19832824-19832846 TCTGCTTGTCTGTGCATGAATGG - Intergenic
1165283526 19:34817809-34817831 TGTGAATGTGTGTGAATTACTGG - Intergenic
1166346780 19:42171321-42171343 TGTGTCTGTGTGTGAATAAGGGG + Intronic
1167207831 19:48114376-48114398 TGTGATCTTATGTGACTAAAGGG + Intergenic
926458663 2:13100430-13100452 TGTTCTTGTCTGTGAATAGTTGG + Intergenic
926695578 2:15768048-15768070 TGTGTTTGTCTGAGAAGGAAAGG + Intergenic
927272196 2:21223749-21223771 AGCGATTGTCTTTGGATAAATGG + Intergenic
927512329 2:23651952-23651974 TGTGATTGTATCTGGAGAAAGGG - Intronic
928020197 2:27698546-27698568 TGGGATTGTCTGGGGGTAAAAGG + Intergenic
932721864 2:74144522-74144544 TGTGTGTGTGTGTGGATAAAGGG + Intronic
933583399 2:84152569-84152591 TGAGATTTTCTGTTAATAAATGG + Intergenic
933901570 2:86854148-86854170 TGGGATTATCTGAGAATGAAAGG + Intronic
935054136 2:99551132-99551154 TGTGATTGTGTGTGAGTGTACGG + Exonic
935199313 2:100842513-100842535 TGTGAGTGTCAGTAAAGAAAGGG + Intronic
935778977 2:106495120-106495142 TGGGATTATCTGAGAATGAAAGG - Intergenic
935797320 2:106657391-106657413 TGTGTGTGTGTGTGAATAAAAGG - Intergenic
935842443 2:107128208-107128230 TGTGTGTGTGTGTGTATAAAGGG - Intergenic
936474858 2:112831225-112831247 GGTGGTTGTCTGGGAATAAGTGG + Intronic
936627055 2:114159387-114159409 TGAGCTTTTCTGTGAAGAAAGGG - Intergenic
938002960 2:127760156-127760178 TGAGAATGTCTGTGAGTAGAAGG + Intronic
939859403 2:147399454-147399476 TGTTATTTTCTCTGAATCAATGG + Intergenic
939957607 2:148539955-148539977 TGTGGTTGACTCTGAAGAAAGGG + Intergenic
940550876 2:155154733-155154755 TGTGACTGTCCTTGAAGAAAGGG - Intergenic
940685077 2:156838601-156838623 TGTGAGTGTCTCTCATTAAAGGG + Intergenic
942798951 2:179854405-179854427 AATGATTGTCTTTGAATGAATGG + Intronic
943096253 2:183433085-183433107 GATGATTTTCTATGAATAAATGG + Intergenic
943976650 2:194487777-194487799 TGTGAGTGTGTGTGTATAATGGG + Intergenic
945636914 2:212366962-212366984 TGTGACTGTATTTGAATACAGGG + Intronic
946606319 2:221409154-221409176 TTTGATCTCCTGTGAATAAAGGG + Intergenic
947065701 2:226222482-226222504 TGTGAGATTCTGTGTATAAAGGG - Intergenic
947215597 2:227747195-227747217 TGTGGTTATTTGTGTATAAATGG - Intergenic
948159003 2:235808793-235808815 TGTTGTTGTCTTTGAATATATGG - Intronic
1169191059 20:3659643-3659665 TCTCAAGGTCTGTGAATAAAGGG + Intronic
1170298273 20:14853186-14853208 TGTGTGTGTGTGTGTATAAATGG + Intronic
1171565124 20:26176414-26176436 TGTGTGTGTGTGTGTATAAATGG + Intergenic
1171570498 20:26245803-26245825 TGTGATTGCCTGTGACTATGTGG + Intergenic
1175735021 20:61379358-61379380 CGTGGTTGTCTGTCAATTAAGGG - Intronic
1176456489 21:6916822-6916844 TCTTATAGTCTGTGAGTAAATGG + Intergenic
1176663014 21:9657794-9657816 TGTGTTTGTCTGTCATTTAAAGG - Intergenic
1176834662 21:13781882-13781904 TCTTATAGTCTGTGAGTAAATGG + Intergenic
1181446125 22:22976266-22976288 TGTGATTTTCTATGAACAGAGGG + Intergenic
1181659920 22:24338533-24338555 TGTAAATGACTGTGAAGAAAAGG - Intronic
1183066489 22:35367065-35367087 TGGGATTGGCTTTGAATAGAGGG - Intergenic
1183163549 22:36130954-36130976 TGGGATTTCCTGTGAAGAAAAGG - Intergenic
949244257 3:1906826-1906848 TGACATTGTATGTGAATAAATGG - Intergenic
949252269 3:2000605-2000627 TATTATTATCTGTGAACAAAAGG + Intergenic
949288943 3:2440584-2440606 TGTGTTTGTCTTTGAATGATGGG + Intronic
950874256 3:16255877-16255899 TGTGATTGTCTGTTTAAATACGG + Intergenic
951680699 3:25291733-25291755 TGTGAATGTGTCTGAAGAAAAGG - Intronic
951919516 3:27838982-27839004 TTTACTTGTCTGGGAATAAACGG + Intergenic
952634739 3:35515065-35515087 TGTGTTTGTGTGTGAGAAAATGG + Intergenic
953149851 3:40314916-40314938 TGTGCTTGTCTGGGATCAAAGGG + Intergenic
953316887 3:41936347-41936369 TGTGATTATCTGTTAAGGAAAGG - Intronic
954905922 3:54062720-54062742 TGTGAGTGTATGTGACTCAATGG + Intergenic
955329863 3:58038417-58038439 TCTGATTGTTTGTGAATTGATGG + Intronic
956229171 3:66994234-66994256 TGTAAAGGTCTGGGAATAAATGG - Intergenic
956514716 3:70034100-70034122 TGAAATTGCCTGAGAATAAATGG + Intergenic
956863557 3:73347954-73347976 TGTGACTGTATTTGAATATAGGG - Intergenic
957108902 3:75927556-75927578 TGTGATTGCCTGTGACTATGTGG - Intronic
957321193 3:78632639-78632661 TTTGATATTCTGTGAATATATGG - Intronic
957507689 3:81145460-81145482 TGTGAGTGACTGAGAAGAAAGGG - Intergenic
957820125 3:85361861-85361883 TGTGTTAGTCTGTGGATAGATGG + Intronic
957914243 3:86666456-86666478 TCTGATTGTCTTTGAATTGATGG - Intergenic
958525751 3:95257236-95257258 TGTGATTGTCTTTGGACATAAGG - Intergenic
959669836 3:108963986-108964008 TGTCATTGCCTGTGAATTACTGG - Intronic
959814040 3:110653961-110653983 TGTGATGGTCAGTGAACATAAGG - Intergenic
960092137 3:113651795-113651817 TGTGACCATCTGTGAATAATTGG - Exonic
960332136 3:116373710-116373732 TCTGAATGTCTTTGAATATATGG + Intronic
962167352 3:133063331-133063353 TCTGATTTTGTGTGAATCAAAGG + Intronic
962934441 3:140066773-140066795 TGTGAGTGTCTGTGAGTGAAAGG - Intronic
963399819 3:144783999-144784021 TATGAATGTTTATGAATAAAGGG + Intergenic
963459975 3:145599730-145599752 TGGTATTGTCCTTGAATAAATGG - Intergenic
965040683 3:163502081-163502103 TGTGTGTGTGTGTGATTAAATGG - Intergenic
965297176 3:166962956-166962978 AGTGATTGTATGTGTATAATAGG - Intergenic
965700410 3:171454934-171454956 TGTGTTTGTATTTGAATAATCGG + Intronic
966923952 3:184632510-184632532 TGTGAGTGTGTGTAGATAAATGG - Intronic
966990345 3:185223799-185223821 TATGCTTTTCTGTGAACAAAGGG + Intronic
968273310 3:197421371-197421393 TGTGGTGGTCTAAGAATAAAAGG - Intergenic
970062683 4:12052439-12052461 TGTGATTCTCTGAGACTACAAGG - Intergenic
970768829 4:19585326-19585348 TGTGATTGTCTTTGCAGACAGGG + Intergenic
970975940 4:22042957-22042979 TGTGTGTGTTGGTGAATAAAAGG + Intergenic
971609334 4:28701988-28702010 TGTGTTTCTGTGTGAATAGAAGG + Intergenic
972163146 4:36249530-36249552 TGTGACTATCAGTGAATCAATGG - Intergenic
972173129 4:36371798-36371820 TGTGATTGACTGTAATTAAAAGG - Intergenic
972366661 4:38382150-38382172 AGTGATTTTCTGTGAATAGCTGG + Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
974693141 4:65327633-65327655 TGTGATTTTCAGTGAAAACATGG + Intronic
975356299 4:73409139-73409161 TGTGTGTGTGTGTGCATAAATGG - Intronic
975359539 4:73451972-73451994 TGTATATGTATGTGAATAAAAGG + Intronic
975654338 4:76626602-76626624 TGGCATTGACTCTGAATAAATGG - Intronic
976512884 4:85931226-85931248 TATTATTGTCTGTGAATAGGTGG + Intronic
976761774 4:88556976-88556998 TGTGAATATATGTGAATATAAGG - Intronic
976942041 4:90714197-90714219 TGTGATTGTCTTTGAATAGTTGG + Intronic
977311224 4:95390290-95390312 TGTGCCTGTCTTTGAATAAATGG - Intronic
978697747 4:111603107-111603129 TGTGACTGTCTGTGGAGAAAGGG - Intergenic
979089563 4:116464926-116464948 TGCCATTGTCTGTCAATAAAAGG + Intergenic
979220934 4:118224020-118224042 TGTGATTGTCTTTCAATGCATGG + Intronic
979735806 4:124082109-124082131 TGTGTTTTAGTGTGAATAAATGG - Intergenic
979936598 4:126705369-126705391 TGTGATTGTATTTGCATAAAGGG - Intergenic
981648796 4:147031582-147031604 TGTGATTGTTTATGAAAAAGAGG + Intergenic
983012185 4:162561837-162561859 TGTGCTTGTTTGTGTTTAAAAGG - Intergenic
983114013 4:163789772-163789794 TTTTATTATTTGTGAATAAATGG + Intronic
984124580 4:175791751-175791773 TGCGTGTGTGTGTGAATAAATGG - Intronic
984589547 4:181601780-181601802 TGTGATTGTCTTTGCAGATAAGG - Intergenic
985086837 4:186322592-186322614 TGTGATTATCTCTAAATGAAAGG - Intergenic
985412309 4:189698249-189698271 TGTGTTTGTCTGTCATTTAAAGG + Intergenic
986257112 5:6109640-6109662 TGTGATTATCTGTGATTCATAGG - Intergenic
986370311 5:7073737-7073759 TGTGAGTGTCTGTGCTTAGAAGG - Intergenic
986455822 5:7916761-7916783 TGAGATGGTGTGTGAATGAATGG - Intergenic
987417033 5:17672745-17672767 TCTGATTGTCAGTGAGTCAAAGG + Intergenic
987517872 5:18937694-18937716 TGTGATGTTATTTGAATAAAGGG + Intergenic
988890266 5:35609094-35609116 TGTGTGTGTGTGTGATTAAAGGG - Intergenic
989540982 5:42618646-42618668 TACGATTGCCTGTGAATTAATGG - Intronic
990705829 5:58528460-58528482 TGTGATTTTCTGTGAGCAACTGG + Intergenic
991573482 5:68079308-68079330 TGAGATTGTCACTGATTAAATGG + Intergenic
991936870 5:71810774-71810796 TTTGATTGTCAGTGGTTAAAAGG - Intergenic
993327692 5:86562800-86562822 TGTGATTGTATTTGAAGATAGGG - Intergenic
993462498 5:88201013-88201035 TGTGATAGATTGTGAAAAAATGG - Intronic
993943412 5:94089587-94089609 TGTGTGTGTGTGTGTATAAACGG - Intronic
994352632 5:98764597-98764619 TGTGTGTGTGTGTGTATAAAAGG + Intergenic
994434845 5:99714054-99714076 TGTGATTGCCAGGGATTAAAAGG - Intergenic
994833189 5:104812043-104812065 TGTGCATGTCTGTGAATGCACGG + Intergenic
994866485 5:105279143-105279165 TGTGACTGTATTTGCATAAAGGG - Intergenic
995268991 5:110199563-110199585 TGTGAGTTTCTTTGGATAAAGGG + Intergenic
995813136 5:116132107-116132129 TGTGATAGTCTGGGAATATGTGG + Intronic
995830748 5:116352782-116352804 TGTGATTGCTTGTGTAGAAAGGG + Intronic
996606812 5:125332651-125332673 TGAGGTTGTCTGTGAAGAACTGG + Intergenic
997034894 5:130178081-130178103 TGTGATTATGTGTGGATAGATGG + Intronic
997781466 5:136663203-136663225 TGTGTGTGTGTGTGAATAGAGGG - Intergenic
1000446185 5:161324213-161324235 TGTCATTAAATGTGAATAAAAGG + Intronic
1001159770 5:169302298-169302320 TGTGATTGCCGGTGTATAAATGG - Intergenic
1002425150 5:179170583-179170605 TGTGCTTCTCTGTGAGCAAAAGG + Intronic
1003811039 6:9780948-9780970 TGTGTGTGTGTGTGTATAAAGGG - Intronic
1004112834 6:12737030-12737052 TGTGAATGTGTGTGTATATATGG - Intronic
1005438824 6:25843028-25843050 TGTGATTGTATTTGAAAATAGGG + Intronic
1008124955 6:47657852-47657874 TCTCATTATCTGTGAATAAGAGG - Intronic
1008246925 6:49187544-49187566 AGTGATAGTCTGTGAAGATAGGG - Intergenic
1009310126 6:62139785-62139807 CGTGATTGTCAATTAATAAATGG - Intronic
1009348148 6:62643020-62643042 TGTGATTGAATGTCAATAAGAGG + Intergenic
1009515623 6:64613378-64613400 TGTGATTGTTTTAGAATGAAAGG - Intronic
1009602892 6:65825873-65825895 TGTTATTGTGTGTGAATATCCGG + Intergenic
1009836207 6:69004737-69004759 TGTGATTGTCTTTGGACATAGGG - Intronic
1010144650 6:72653000-72653022 TGTGATTGTCTGTGAATAAATGG - Intronic
1010219755 6:73438230-73438252 TGTGAGTGTATGTGAACAGAGGG - Intronic
1010492921 6:76495673-76495695 TCAGCTGGTCTGTGAATAAAGGG + Intergenic
1010597587 6:77783157-77783179 TGTGATTGCCAGGAAATAAAAGG - Intronic
1011801822 6:91025039-91025061 TTTGATGGTATATGAATAAAAGG + Intergenic
1012087115 6:94842192-94842214 TGTGATAGTATTTGAAGAAAGGG - Intergenic
1012334464 6:98037637-98037659 TGCGAACGTTTGTGAATAAAAGG - Intergenic
1012741608 6:103022484-103022506 TTTTATTGTCTGGAAATAAAAGG - Intergenic
1012951206 6:105519883-105519905 GGTGGTTGTCTCTGAATAAAGGG - Intergenic
1015503465 6:133957071-133957093 TCTACTTGTCTGTGACTAAAGGG + Intronic
1016023814 6:139263680-139263702 TGTTATTCTTTTTGAATAAAAGG + Intronic
1016880146 6:148903134-148903156 TGTGATTCTCTATCAAAAAAAGG - Intronic
1016942301 6:149492852-149492874 TGTGCTTAGCTGTGAGTAAATGG - Intergenic
1018102374 6:160452444-160452466 TGCAAGTGACTGTGAATAAAGGG - Exonic
1018133413 6:160754008-160754030 TGCAAGTGACTGTGAATAAAGGG + Intergenic
1018722611 6:166584355-166584377 TGTGATTCTATGTGGAGAAAGGG - Intronic
1019067699 6:169316264-169316286 TGTGTGTGTGTGTGAATGAATGG - Intergenic
1020527372 7:9279376-9279398 TTTGATTAGCTTTGAATAAAAGG - Intergenic
1020531660 7:9345885-9345907 TTTCATTATCTGTGAATAGAGGG - Intergenic
1021176365 7:17454370-17454392 TTAGATTGTCTGGGCATAAAGGG + Intergenic
1023366587 7:39470577-39470599 TGTGTGTGTGTGTGTATAAAGGG - Intronic
1023384958 7:39647397-39647419 TGTGATTGTTTCTGATCAAAAGG + Intronic
1024032975 7:45480695-45480717 GGTGACTGTCTCTGATTAAAAGG - Intergenic
1026389651 7:69887593-69887615 TGTGATAGTATGTGAATACCTGG + Intronic
1026567012 7:71497549-71497571 TGTGATTGTATTTGGAGAAAGGG - Intronic
1028253849 7:88567703-88567725 TGAGATTGTTTGTGATCAAAAGG + Intergenic
1028552287 7:92082288-92082310 AATGATTTTCTGGGAATAAAAGG - Intronic
1031256595 7:119458710-119458732 TAAAATTATCTGTGAATAAAAGG + Intergenic
1032080611 7:128856731-128856753 TGTGCTTGTCTGTGGATAAAGGG - Exonic
1032988939 7:137369191-137369213 TGTCATTATCTGAGAATAATTGG + Intergenic
1034852556 7:154508531-154508553 AGTGACTGACTGTGAATTAATGG - Intronic
1035828103 8:2665934-2665956 TGACATTGTTTGTGACTAAAGGG - Intergenic
1036068621 8:5413994-5414016 TGTCAATGTTTCTGAATAAATGG + Intergenic
1036506761 8:9363948-9363970 TGTGCTTGACGGTGATTAAATGG - Intergenic
1038925310 8:32132651-32132673 TGTGTTTGTGTGTGAATGCATGG + Intronic
1039855033 8:41404517-41404539 TGTGATTATCTGTGAGTGACAGG + Intergenic
1040088802 8:43373869-43373891 TGTGTTTGTGTGTGTCTAAAAGG + Intergenic
1040924928 8:52670269-52670291 TTTTATTATCTGTGAACAAATGG - Intronic
1043113182 8:76214152-76214174 TGAGAATGTTTGTAAATAAAGGG + Intergenic
1043136739 8:76536661-76536683 TGTAAATGTGTGTAAATAAAAGG - Intergenic
1043524964 8:81086514-81086536 TGTGTGTGTGTGTGCATAAAAGG + Intronic
1044511706 8:93088655-93088677 TCTGTTTTTCTGTGTATAAAAGG - Intergenic
1045295574 8:100869341-100869363 TCTGTTTTTCTGTGGATAAAAGG + Intergenic
1045329633 8:101143806-101143828 TATGCTTTTCTGTGTATAAATGG + Intergenic
1046117897 8:109806169-109806191 TGTTATAGGCTATGAATAAACGG - Intergenic
1046913705 8:119657718-119657740 TGTGTTTGTCTAGGAATGAAAGG + Intronic
1047621328 8:126611141-126611163 TGTGTCTGCCTCTGAATAAATGG - Intergenic
1048579250 8:135717786-135717808 TGTGTGTGTCTTTTAATAAAGGG - Intergenic
1048853326 8:138664831-138664853 TTTGATTGTCAGTGAAAAGAAGG - Intronic
1051581213 9:18676936-18676958 TGTGATTGTTCGGGAAGAAATGG - Intronic
1052110250 9:24573779-24573801 TGTGATTGTCTTTGCAAAAGAGG - Intergenic
1052668168 9:31520768-31520790 TGTGATTTCCAGTTAATAAAAGG + Intergenic
1052985615 9:34485055-34485077 TGGGAGTGTTTGTGAATGAAGGG + Intronic
1053155965 9:35779534-35779556 TGTGAGTTTCTGTGATCAAAGGG + Intergenic
1055104575 9:72499351-72499373 TGTGATTGTATTTGGAGAAAAGG + Intergenic
1055284834 9:74717240-74717262 TGTGTGTGTGTGTAAATAAAAGG - Intergenic
1055732588 9:79293635-79293657 TGTGATTGTATTTGAAGATAAGG - Intergenic
1055957480 9:81787662-81787684 TGTGACTGTATTTGAAAAAAAGG - Intergenic
1055969791 9:81900437-81900459 TGTGATTAACTGTGAAAAGAAGG - Intergenic
1057032622 9:91787737-91787759 TGTGATTCTCTGTTAAAAATTGG - Intronic
1058040819 9:100299626-100299648 TGTGTGTGTGTGTCAATAAAAGG - Intronic
1059773070 9:117445944-117445966 TGAGATTGGGTGGGAATAAAAGG + Intergenic
1060004003 9:119983582-119983604 TGTAATTGTCTGAGAAAAGAGGG + Intergenic
1060536778 9:124396000-124396022 TGTGGTTGACTGTGTATAAGAGG - Intronic
1060690916 9:125659387-125659409 TGTGAATGTCTGAGAATGAAAGG - Intronic
1062292102 9:135800370-135800392 TGTGATTGTCTTTGGAGACAGGG + Intergenic
1062665413 9:137668461-137668483 TGTGATGGTTGGTGAATAGATGG - Intronic
1203670284 Un_KI270755v1:4732-4754 TGTGTTTGTCTGTCATTTAAAGG - Intergenic
1185891155 X:3823419-3823441 TGTGAGTGTATGTGAATGAGTGG + Intronic
1185896261 X:3861835-3861857 TGTGAGTGTATGTGAATGAGTGG + Intergenic
1185901380 X:3900261-3900283 TGTGAGTGTATGTGAATGAGTGG + Intergenic
1186083283 X:5956982-5957004 TGTGTTTGTGTGTGTTTAAAGGG + Intronic
1186188818 X:7049084-7049106 AGTGATTGTCTGTGAATGACAGG - Intronic
1186736258 X:12467835-12467857 TTTGATTTTATGTGAATGAAGGG + Intronic
1186859960 X:13663140-13663162 TTTGATGTTCTTTGAATAAAGGG - Exonic
1187231917 X:17431509-17431531 TGTGACTGGCTGTGATTGAAGGG + Intronic
1187470663 X:19566630-19566652 AGTAATTGGCTGTGAATGAAAGG - Intronic
1189057757 X:37716480-37716502 TGTGAGTGTCTGTGGTTCAAGGG + Intronic
1189354027 X:40298152-40298174 TGTGATTCTCTGAGCACAAAGGG - Intergenic
1190905906 X:54727901-54727923 TGTGTGTGTGTGTGTATAAATGG - Intergenic
1191055647 X:56237453-56237475 TGTTACTATCTGTGTATAAAAGG - Intronic
1192800576 X:74461443-74461465 TGTGTCTGTCTGTGAAAAAGAGG + Intronic
1192899016 X:75474566-75474588 TGTGTGTGTGTGTGTATAAAGGG - Intronic
1193037137 X:76964051-76964073 TGTGAATGCCTGTGAATCAGTGG + Intergenic
1193530699 X:82650761-82650783 TGTGATTTTCTGGAAACAAAGGG - Intergenic
1194227990 X:91285464-91285486 TGTGATTGTATTTGTATACAGGG + Intergenic
1194868344 X:99097242-99097264 TGTGATTGTCTTTGGAGATAGGG - Intergenic
1196032443 X:111105227-111105249 TGTGAGTGTCTGTGAACATGAGG - Intronic
1196060496 X:111403118-111403140 GGTTATTGGCTGTGAATATATGG - Intronic
1196070392 X:111514898-111514920 TGTGTGTGTGTGTAAATAAAAGG + Intergenic
1197443603 X:126521134-126521156 AATGATTGCCTATGAATAAAGGG + Intergenic
1198654985 X:138903970-138903992 TATGATTGACTATGTATAAATGG + Intronic
1199013119 X:142779972-142779994 AGTGAGTGACTGGGAATAAATGG + Intergenic
1199609800 X:149603189-149603211 TGAAATTAACTGTGAATAAATGG - Intronic
1201510841 Y:14760417-14760439 TATGATTGTGTGTGAAAAACTGG - Intronic