ID: 1010145589

View in Genome Browser
Species Human (GRCh38)
Location 6:72665365-72665387
Sequence AGTTTTAAGACTGTGAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5906
Summary {0: 1, 1: 0, 2: 0, 3: 157, 4: 5748}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010145585_1010145589 30 Left 1010145585 6:72665312-72665334 CCAGCCTGGACGACAGAGTAATA 0: 1
1: 72
2: 3341
3: 53018
4: 205382
Right 1010145589 6:72665365-72665387 AGTTTTAAGACTGTGAGTTGAGG 0: 1
1: 0
2: 0
3: 157
4: 5748
1010145587_1010145589 7 Left 1010145587 6:72665335-72665357 CCCTGTCAAAAAAAAAAAAAAAA 0: 1123
1: 88135
2: 78955
3: 100732
4: 165604
Right 1010145589 6:72665365-72665387 AGTTTTAAGACTGTGAGTTGAGG 0: 1
1: 0
2: 0
3: 157
4: 5748
1010145586_1010145589 26 Left 1010145586 6:72665316-72665338 CCTGGACGACAGAGTAATACCCT 0: 1
1: 5
2: 531
3: 8015
4: 55410
Right 1010145589 6:72665365-72665387 AGTTTTAAGACTGTGAGTTGAGG 0: 1
1: 0
2: 0
3: 157
4: 5748
1010145588_1010145589 6 Left 1010145588 6:72665336-72665358 CCTGTCAAAAAAAAAAAAAAAAA 0: 488
1: 3801
2: 22810
3: 59284
4: 170819
Right 1010145589 6:72665365-72665387 AGTTTTAAGACTGTGAGTTGAGG 0: 1
1: 0
2: 0
3: 157
4: 5748

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010145589 Original CRISPR AGTTTTAAGACTGTGAGTTG AGG Intronic
Too many off-targets to display for this crispr