ID: 1010152269

View in Genome Browser
Species Human (GRCh38)
Location 6:72747155-72747177
Sequence GCCATAACCCCTGAGGTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010152269_1010152272 18 Left 1010152269 6:72747155-72747177 CCACAAACCTCAGGGGTTATGGC 0: 1
1: 0
2: 0
3: 3
4: 119
Right 1010152272 6:72747196-72747218 TTAATTTTAAATTATATCACAGG 0: 1
1: 0
2: 11
3: 88
4: 757

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010152269 Original CRISPR GCCATAACCCCTGAGGTTTG TGG (reversed) Intronic
901827547 1:11872248-11872270 GGCATAAGCCCAGGGGTTTGAGG - Intergenic
902212783 1:14915655-14915677 TCCATAACCCCTGATGTGGGAGG + Intronic
902533865 1:17107718-17107740 CCCATAGCCCCTGAAGTCTGTGG - Intronic
907369474 1:53991655-53991677 GCCATAAACTCTGTGGTTGGTGG + Intergenic
908323686 1:63002728-63002750 GCCCTGACCCCTGGGATTTGGGG - Intergenic
908432496 1:64072721-64072743 GCCAGCACCCCTGAGGTTCCTGG - Intronic
916198587 1:162248606-162248628 GCCATAACCCCTGAGGCTAAAGG - Intronic
1065197096 10:23277057-23277079 CACAGAACCCCTAAGGTTTGGGG - Intronic
1066441346 10:35442159-35442181 GCCATAACTCCTGATGTGTAGGG + Intronic
1067531210 10:47075156-47075178 TCGAAAACCTCTGAGGTTTGGGG - Intergenic
1067840890 10:49678870-49678892 TCCATAACCACTGAGATTTTGGG - Intergenic
1068005139 10:51384359-51384381 GCCATAAGCACTGAGGTCTCAGG - Intronic
1069069790 10:63981486-63981508 GCCATTACCCTAGAGATTTGTGG + Intergenic
1069719273 10:70539440-70539462 GCTGTGACCCCTGAGGCTTGGGG + Intronic
1070652510 10:78247996-78248018 CCCATTTCCCCTGAGGCTTGTGG + Intergenic
1071360233 10:84839115-84839137 ACCAGAACCACTGTGGTTTGGGG + Intergenic
1074028933 10:109664857-109664879 GCCAGAACCTCTGTGGCTTGTGG - Intergenic
1074241960 10:111648737-111648759 GCAATTACCTCTGAGGGTTGCGG + Intergenic
1074406651 10:113185368-113185390 GCCAGATCCCCTGAAGTTGGGGG - Intergenic
1074514405 10:114152003-114152025 GCCATAACTTTTGAAGTTTGAGG - Intronic
1076030779 10:127156128-127156150 GACATTTCCCCTGAGGTTTAGGG - Intronic
1087922629 11:103883935-103883957 GCCCTCACCTCTGAGGTTAGTGG - Intergenic
1088767872 11:113002114-113002136 CCCCTAACCCCTGAAGTTGGAGG + Intronic
1094663507 12:32495206-32495228 GCCACAATCTCTGAGCTTTGAGG - Intronic
1094765217 12:33586779-33586801 GACAAAACCCCTGTGGTTTTAGG - Intergenic
1097667087 12:62491860-62491882 GCCAGAACCACTGAAGTGTGAGG - Intronic
1099114471 12:78607532-78607554 GACAAAACCCCTGGAGTTTGAGG - Intergenic
1100436403 12:94575256-94575278 GCTAGAAGCCCTGAGGATTGTGG + Intronic
1100462761 12:94817282-94817304 GACATAACCGCTTAGGTTAGGGG - Intergenic
1114035107 14:18617110-18617132 GGAATAACACCTGAGGCTTGGGG + Intergenic
1114123538 14:19697906-19697928 GGAATAACACCTGAGGCTTGGGG - Intergenic
1120969807 14:90197916-90197938 GCCATTACCCCAGTGGTATGAGG + Intergenic
1121281309 14:92700898-92700920 GCCATAACTCCAAAGGTTAGAGG + Intergenic
1121328809 14:93036867-93036889 GTCACAAGCACTGAGGTTTGGGG - Intronic
1121796977 14:96743278-96743300 GCCACCACACCTGAGCTTTGGGG + Intergenic
1202836905 14_GL000009v2_random:85224-85246 GTCATTTCCCCTGAGGTTGGTGG - Intergenic
1128936515 15:71750573-71750595 GCCATATGCCATGAGGTGTGGGG - Intronic
1129998532 15:80027409-80027431 GCCATAGCCACTGAGATTTAGGG - Intergenic
1131020307 15:89092168-89092190 ACCATTACCCCTGAAGCTTGTGG + Intronic
1134674086 16:16077178-16077200 CCCATCACCCCTGTGTTTTGCGG - Intronic
1135284256 16:21179852-21179874 GACATAAGCCCTGAGGCTTTGGG - Exonic
1140393621 16:74608876-74608898 GGCAGATCGCCTGAGGTTTGGGG - Intergenic
1141688863 16:85585406-85585428 GGCATGACCCCTGAGCTTGGAGG + Intergenic
1141740372 16:85887749-85887771 CCCATAATCCATGAGGATTGAGG - Intergenic
1143118957 17:4595642-4595664 GCCACAACCCCTGGGGAATGTGG - Intronic
1145811797 17:27768816-27768838 GACCTAAGCCCTCAGGTTTGTGG + Intronic
1150590768 17:66560164-66560186 GGCATACCCCCAGAGGCTTGAGG + Intronic
1156228239 18:35129852-35129874 GCCATAACCCAAGAGGGATGAGG + Intronic
1164419425 19:28075675-28075697 GCCATCACCCCTGCAGTCTGGGG - Intergenic
1168266076 19:55224777-55224799 CCCATAATCCCTGGTGTTTGGGG - Intergenic
1202635728 1_KI270706v1_random:42126-42148 GTCATTTCCCCTGAGGTTGGTGG + Intergenic
925723567 2:6851636-6851658 GCCATAGCCACTGAGGTGAGTGG - Exonic
927641742 2:24849811-24849833 GCCAGAGGCCCTGAGGCTTGGGG - Intronic
938549982 2:132371004-132371026 TCCATAGAGCCTGAGGTTTGAGG + Intergenic
939649615 2:144745013-144745035 GCTGAAAACCCTGAGGTTTGGGG - Intergenic
947743362 2:232495130-232495152 GCCACAAACCCTGAGCTTAGAGG - Intergenic
1170200648 20:13740055-13740077 GCCACAAACCCAGGGGTTTGTGG - Intronic
1171159271 20:22906848-22906870 GCCTTACCCACTGAGGTTAGTGG - Intergenic
1173497278 20:43528801-43528823 GCCAGAAGGCCTGAGGTTGGTGG - Intronic
1175091100 20:56504977-56504999 GCCACAACCCCTGAAGATTATGG - Intronic
1177698133 21:24599815-24599837 GCTATAAGCCATGAAGTTTGTGG - Intergenic
1178116541 21:29423529-29423551 GCCATTATCTCTCAGGTTTGGGG - Intronic
1180459228 22:15544158-15544180 GGAATAACACCTGAGGCTTGGGG + Intergenic
1181563228 22:23717587-23717609 GACAGAACCCCTGAGATTGGTGG + Intergenic
1181590774 22:23883715-23883737 GCCATGGTCCCTGAGGTCTGGGG - Intronic
1184212988 22:43047692-43047714 GGCAGAACCCCTGAGGTCAGGGG - Intronic
1184490013 22:44803106-44803128 GAAATCACCCCTGTGGTTTGGGG + Intronic
1184613657 22:45622882-45622904 GCCATGACCACAGAGGTTTCCGG + Intergenic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
1185132265 22:49046053-49046075 CCCACAGCCCCTGAGGCTTGGGG + Intergenic
1185339930 22:50286682-50286704 CCCATGTCCCCTGAGTTTTGGGG - Intronic
950119541 3:10472475-10472497 GGCATAGCTCCTGAGGCTTGCGG + Intronic
950151535 3:10691383-10691405 CCCATAACTACTGAGGTATGTGG - Intronic
954259066 3:49425694-49425716 CCCATATCCCCTGACCTTTGGGG - Intronic
955199674 3:56839690-56839712 GCCAGACCCCTTGAGATTTGGGG - Intronic
956096801 3:65724917-65724939 CCCATAACCCCCGAGTGTTGTGG - Intronic
956721928 3:72125586-72125608 ACCATAACCCCAGAGGTATCTGG - Intergenic
957132526 3:76240803-76240825 GCCATAAACACTGAGGGTTTTGG + Intronic
958870144 3:99548777-99548799 ACAATAACCCCTGAGGGATGGGG + Intergenic
959857302 3:111174706-111174728 GCTCAAACCACTGAGGTTTGGGG + Intronic
965035790 3:163435895-163435917 GCCATAATCCCAGAACTTTGGGG + Intergenic
968697665 4:2040960-2040982 GCCAGAACCCCGGGGGTTGGGGG + Intronic
969347262 4:6577124-6577146 GCGATAGTCCCTGTGGTTTGAGG + Intronic
969507193 4:7595427-7595449 GCCCTAACCCCTGACCTCTGGGG - Intronic
971085440 4:23269707-23269729 GCCATGTCCCCAGACGTTTGTGG + Intergenic
972854447 4:43090015-43090037 GCCAGGACGCCTGAGGTGTGTGG - Intergenic
980003790 4:127518050-127518072 GTCATAAACCTTGAGGTTTAGGG - Intergenic
982083178 4:151809716-151809738 GCCATACCCAGTGAGGTCTGTGG - Intergenic
982222676 4:153138238-153138260 GCCAGACCCCCTGATGTGTGTGG - Intergenic
1202763051 4_GL000008v2_random:128006-128028 GTCATTTCCCCTGAGGTTGGTGG + Intergenic
986413803 5:7508312-7508334 GCAATAGCCACTGAGATTTGGGG - Intronic
1005469178 6:26145008-26145030 TCTATAAGCCCTGGGGTTTGGGG - Intergenic
1005983912 6:30858554-30858576 GCCATCACCCCTGCCATTTGAGG - Intergenic
1006108312 6:31729607-31729629 CCCATAACCCCTGCGGGTCGCGG - Exonic
1010152269 6:72747155-72747177 GCCATAACCCCTGAGGTTTGTGG - Intronic
1013708029 6:112862614-112862636 GCCATAACTTTTGAAGTTTGAGG + Intergenic
1013862845 6:114657759-114657781 GCCAGAAGCACTGAGGTTTAAGG + Intergenic
1013944364 6:115704349-115704371 CCCAAAACCCCTGGAGTTTGAGG - Intergenic
1014399183 6:120965862-120965884 ACCCTAACCTCTGAGGTTTTTGG - Intergenic
1017833275 6:158151968-158151990 GACATGACCCCAGAAGTTTGAGG - Intronic
1018681900 6:166271635-166271657 GCCATGGCCCCTGAGGTCAGCGG - Intergenic
1019169046 6:170118828-170118850 GCCATAACAACAGAGGTTTAAGG - Intergenic
1022692440 7:32669914-32669936 GCCATTTCCTCTGAGGGTTGAGG + Intergenic
1024009177 7:45253164-45253186 GCCACATCCCTTGAGGTCTGAGG + Intergenic
1024980947 7:55157093-55157115 CCCATAACCCCTGAGGGTAGAGG + Intronic
1026136006 7:67661375-67661397 GCCTAAATCCCTGAGGTCTGGGG + Intergenic
1034531272 7:151697644-151697666 GACATAACCCCTTAGCTGTGGGG + Intronic
1036605431 8:10301574-10301596 GCCAGAACACATGAGTTTTGAGG + Exonic
1040074223 8:43213064-43213086 GCCATACCCCCTGAACTCTGTGG - Intergenic
1046136458 8:110033634-110033656 GCCTTAAGCCCAGAAGTTTGAGG + Intergenic
1048108828 8:131443648-131443670 TCACTAACCTCTGAGGTTTGAGG + Intergenic
1053486343 9:38459607-38459629 GCAATAACCCCTCACGTGTGTGG + Intergenic
1054904139 9:70400116-70400138 GCCATAACACCTGAGGAGTTGGG + Intronic
1055207676 9:73751917-73751939 GCCATAATCCCAGAGGTCTGTGG + Intergenic
1060980456 9:127788678-127788700 TCCATCACCCCTGAGGTACGGGG + Exonic
1203543815 Un_KI270743v1:112887-112909 GTCATTTCCCCTGAGGTTGGTGG + Intergenic
1187457545 X:19455860-19455882 GCCATCACGCCTGAGGTTCTTGG - Intronic
1188549346 X:31345330-31345352 GCCATAAGCTCTGAGCTGTGAGG - Intronic
1192566141 X:72165200-72165222 GCCAGATCACCTGAGGTTGGGGG - Intergenic
1194366281 X:93018470-93018492 CCCATAACCTCAAAGGTTTGTGG - Intergenic
1200674506 Y:6134732-6134754 CCCATAACCTCAAAGGTTTGTGG - Intergenic
1202345950 Y:23927136-23927158 GGCAGATCCCCTGAGGTTGGCGG - Intergenic
1202524821 Y:25742954-25742976 GGCAGATCCCCTGAGGTTGGCGG + Intergenic