ID: 1010157149

View in Genome Browser
Species Human (GRCh38)
Location 6:72808283-72808305
Sequence AGGAGTATTCACTTTGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010157149 Original CRISPR AGGAGTATTCACTTTGGGAA TGG Intronic
903455208 1:23482982-23483004 AGGAGCATCGACTTTGGGGAAGG - Intronic
904460272 1:30672988-30673010 AGGACTATACCCTTTGTGAATGG + Intergenic
905012181 1:34755180-34755202 AGGAGTAGTCACTCAGGTAAGGG + Exonic
905075924 1:35269944-35269966 AGGAGTCTTCCTTTTGGGAATGG + Intronic
908925461 1:69249372-69249394 AGGAGTATTTACTTTGCAAGAGG + Intergenic
910430818 1:87157997-87158019 AAGAGTAGGCATTTTGGGAAGGG + Intronic
911831290 1:102553888-102553910 AAAAGTATTAATTTTGGGAATGG - Intergenic
912614951 1:111090045-111090067 AGAAGTATTCTCTATGGCAAGGG + Intergenic
914765218 1:150631403-150631425 AAGAGGAGTCAATTTGGGAATGG + Intergenic
916913890 1:169384845-169384867 AGGAGTTTACAATTTGGGAGAGG - Intronic
918031527 1:180817766-180817788 AGGAGTTTACCCTTGGGGAATGG + Intronic
918454326 1:184692361-184692383 TGGAGAATTCACTTTGGGGAGGG - Exonic
918574046 1:186034093-186034115 AGGATTATTAAATGTGGGAAAGG + Intronic
918898987 1:190388062-190388084 AGGAGAATTTACCTGGGGAATGG - Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920229993 1:204463891-204463913 AGGAGTCTTGACTGTGGGATTGG + Intronic
921886900 1:220316310-220316332 AGGAGAATTCAGAATGGGAAAGG + Intergenic
922226866 1:223653012-223653034 AGATGTTTTAACTTTGGGAAAGG - Intronic
922817456 1:228459817-228459839 AAGAGTTTTCACTTTGGAAAGGG + Exonic
923048486 1:230373014-230373036 AGGAGTTTTCACTTTAATAAAGG + Intronic
923729196 1:236534038-236534060 CGCAGTATTCACTCTGGCAAGGG - Intronic
924630627 1:245736936-245736958 AAGATTATTTATTTTGGGAATGG - Intergenic
1062957022 10:1547185-1547207 AGGTGTATACACTGTGGGGAGGG + Intronic
1062957050 10:1547334-1547356 AGGTGTATACACTGTGGGGAGGG + Intronic
1062957144 10:1547809-1547831 AGGTGTATACACTGTGGGGAGGG + Intronic
1064649007 10:17489336-17489358 TGGAGTTTTCCTTTTGGGAATGG - Intergenic
1064649016 10:17489375-17489397 TGGACTCTTCCCTTTGGGAACGG - Intergenic
1064827056 10:19416333-19416355 AGCACTATTCAATGTGGGAAGGG + Intronic
1068257339 10:54530192-54530214 TGGAGAATTAACTTTGAGAATGG - Intronic
1069803660 10:71102690-71102712 AGGAGTATTATCTCTGGGGAAGG - Intergenic
1071922535 10:90367765-90367787 AGGGGTATTCAATTAGGAAAAGG - Intergenic
1073345907 10:102782779-102782801 AGGAGACTTGGCTTTGGGAATGG + Intronic
1076195596 10:128515430-128515452 AGGCTAATTCACTTTGGGGAAGG + Intergenic
1076944942 10:133640271-133640293 AGGCGTATTCACTATGTGAGGGG + Intergenic
1079232187 11:18658396-18658418 AAGAGGATTTATTTTGGGAAAGG - Intergenic
1081499202 11:43649040-43649062 AGGAGAATTCATTTTTGGTAGGG + Intronic
1081628055 11:44667150-44667172 ATGAGAATTCACTGTGGCAAGGG + Intergenic
1081638054 11:44734006-44734028 ATGAGAATTCACTTGAGGAAGGG - Intronic
1085930612 11:81078596-81078618 ACGAGTATTCACTATGGGCTGGG - Intergenic
1090162486 11:124510287-124510309 AGGAGTGATCACTTAGGGCAAGG + Intergenic
1091215594 11:133899507-133899529 AGGACTCTTCATTTTGGGGAGGG - Intergenic
1093475537 12:19550309-19550331 GGGAGTATTCACTTTTTAAAAGG + Intronic
1094403787 12:30092801-30092823 ATGAGTATTCACTTCTGGATGGG + Intergenic
1095329300 12:40938546-40938568 AGGATTATTTAATTTGGCAAAGG - Intronic
1095369099 12:41444450-41444472 AGGAGTGTTCCCTTTGTGGAAGG - Intronic
1096075443 12:48801030-48801052 CGGAGTATCCACTTTGTGACAGG - Intergenic
1098979654 12:76942281-76942303 GAGAGAATTCACTTTGGGATAGG + Intergenic
1099213397 12:79821895-79821917 ATGAGTATTCATTTTGAGAAGGG + Intronic
1102600495 12:114026111-114026133 AGCAGTGTCCACTTTGGGAAGGG - Intergenic
1104435472 12:128752915-128752937 AGGGGTGTTCACTTGGAGAAGGG - Intergenic
1106013284 13:25844882-25844904 AACAGTGTTCACTTTGGGCAAGG + Intronic
1106111139 13:26777986-26778008 AGCAGTAATGACTTTGGAAAGGG - Intergenic
1107586933 13:41860177-41860199 AGAAGTATAGACTTTGGAAAGGG - Intronic
1110734611 13:78921339-78921361 AGGAGCATTAACTTTCAGAAAGG - Intergenic
1111112869 13:83737278-83737300 ATGAATATTTAGTTTGGGAATGG + Intergenic
1116083673 14:40206875-40206897 AGGAGTCATCACTCTGGAAAAGG + Intergenic
1116310907 14:43326080-43326102 AGCAGTATTCACAATGGCAAAGG + Intergenic
1117528255 14:56633048-56633070 AGAACTATTCACTTTGGCCATGG + Exonic
1117913996 14:60658074-60658096 AGAAGTATGTACTTTTGGAATGG - Intronic
1119784449 14:77301921-77301943 AGGAATATTCACTCTGGCAGAGG - Intronic
1120152527 14:81053266-81053288 AGGCCCATTCACATTGGGAAGGG + Intronic
1120171257 14:81248816-81248838 AAGAGTATGCACTTTGGGAGGGG - Intergenic
1120210771 14:81631438-81631460 AGGATTATTCAGTTAGTGAAAGG - Intergenic
1121499890 14:94426526-94426548 AGGGGTTGTCACTTTGGGCATGG - Intergenic
1124077802 15:26462256-26462278 AGGAGTGGTCACTCAGGGAAGGG - Intergenic
1124954206 15:34349185-34349207 AGGAGAATTCACTTTGAAATAGG + Intronic
1126061765 15:44789729-44789751 GGAAGTATTCACTGTGGTAAAGG - Intergenic
1126687178 15:51258578-51258600 AGGAGGATCCACTTTGGAAAAGG + Intronic
1130908978 15:88257986-88258008 ACGAGCATTCGCTGTGGGAAAGG + Intergenic
1137604065 16:49775644-49775666 AAGTGTATTCACTGTGAGAATGG - Intronic
1137618581 16:49860778-49860800 AGGAGCAGTCATTTTGGGGAGGG + Intergenic
1139395871 16:66638367-66638389 AGAAGTATTGACAATGGGAAAGG - Intronic
1140753512 16:78047091-78047113 AAGAGTGTTCACTTTTTGAAGGG - Intronic
1143034126 17:3984741-3984763 ATGATGATTCACTTTGAGAATGG - Intergenic
1143504783 17:7357681-7357703 AGGAGTTTTTGGTTTGGGAATGG + Intergenic
1145842849 17:28010692-28010714 TGGATTATACTCTTTGGGAATGG - Intergenic
1145905839 17:28515799-28515821 AGGTGTATACACCTGGGGAATGG - Intronic
1146585855 17:34080950-34080972 GGGAGTCTTCACTCTGGGAATGG - Intronic
1146691800 17:34882032-34882054 AGGAGGATCCACCTTGGGAGGGG + Intergenic
1150847463 17:68674315-68674337 ATGAGAATTCACATTGGAAAGGG + Intergenic
1150895168 17:69201338-69201360 AACAGTATTCACTTTGAAAATGG + Intronic
1150897981 17:69236272-69236294 GGGACTACTCACTTTGGGCAGGG - Intronic
1151175557 17:72284988-72285010 AGGTGTTTACACTTGGGGAAGGG + Intergenic
1157957369 18:52113396-52113418 AGGAGGCTTTACCTTGGGAAAGG + Intergenic
1159170776 18:64763541-64763563 AGCAGTATTCACAATAGGAAAGG + Intergenic
1160531289 18:79566355-79566377 CGGAGAAGTCACTTGGGGAAAGG + Intergenic
1164661820 19:29980118-29980140 AGGAATATTAAGTTTGGGCATGG - Intronic
925485801 2:4329258-4329280 AATAGTACTCACTTTGGGAGAGG + Intergenic
926188537 2:10709964-10709986 AGGTGTATCCACTTGGGAAATGG - Intergenic
926366693 2:12139888-12139910 AGAGATATTCACTTTGAGAAGGG + Intergenic
928304900 2:30161200-30161222 AGGAGTTGTTACTTTGGGATTGG + Intergenic
931282936 2:60809455-60809477 GGGAGCATTCACTTTGCCAAAGG + Intergenic
935890039 2:107666616-107666638 AGGAATAGTCACTCTGGGATGGG - Intergenic
938149704 2:128871544-128871566 AGGATTTTCCACTTTGGGATGGG + Intergenic
939036169 2:137134023-137134045 TTGAGTATTCACTTTGTGCATGG + Intronic
939570677 2:143836849-143836871 AGGAGGATTCACTTGAGGCAAGG - Intergenic
941068512 2:160930055-160930077 AGCAGCATTGACTTTGGGGATGG - Intergenic
941715858 2:168762623-168762645 AGTTGTATTCACTCTGGGGAAGG - Intronic
942487079 2:176451248-176451270 GTGAAAATTCACTTTGGGAAAGG + Intergenic
943004132 2:182368855-182368877 ATGAGTGTTCACTATGGGCAAGG - Intronic
943930200 2:193840430-193840452 TGGAAAATTTACTTTGGGAAAGG + Intergenic
945497707 2:210529446-210529468 AGGTTTATGCAATTTGGGAAAGG + Intronic
946787250 2:223260541-223260563 AGGACTGTTCAATTTGGGTAGGG + Intergenic
947448399 2:230182519-230182541 AGGGGGATTCACTTTGGGGTTGG + Intronic
1170369537 20:15633828-15633850 AGGAGTGTTCACTCTGTAAATGG + Intronic
1171052854 20:21876688-21876710 AGAAGTTATCAGTTTGGGAAAGG + Intergenic
1171097847 20:22349286-22349308 ATCAGTAATCATTTTGGGAAAGG + Intergenic
1171109531 20:22467438-22467460 AGCAGAATTCACGTTTGGAATGG + Intergenic
1171147079 20:22794300-22794322 AAGAGTATGCACTCTTGGAAAGG - Intergenic
1172038770 20:32029173-32029195 TGGAGTAAACATTTTGGGAATGG + Intronic
1173284103 20:41654956-41654978 AGGAGAATTCCCTTCTGGAAGGG + Intergenic
1174775071 20:53335736-53335758 CTGAGTATTCCCTCTGGGAAAGG - Intronic
1177950432 21:27529166-27529188 TGGCGTATGGACTTTGGGAAGGG - Intergenic
1181008526 22:20026454-20026476 AGGAGTTCTCATTTTGGGACAGG + Intronic
1182668823 22:31978675-31978697 AGGAGTATTTGTTTTGGGAATGG + Intergenic
1183027047 22:35073069-35073091 AGGACTGTTTACTTTGAGAAAGG - Intronic
1185173899 22:49308269-49308291 AGGAGTGCACACTTTGGGATGGG + Intergenic
949112814 3:283068-283090 AGATGTATTCACTATGTGAATGG - Intronic
949836470 3:8275399-8275421 AGGAGTACTGAGTTTGGGAGAGG - Intergenic
950346555 3:12299614-12299636 AGGATTATTCACTTTGCAAAAGG + Intronic
951419203 3:22463852-22463874 AAGATTATTCACCTTGGGCAGGG + Intergenic
951438367 3:22691589-22691611 AGGCCTATTCACATTGGGGAGGG + Intergenic
954056118 3:48027384-48027406 GTGAGTATTCATTTTGGGGAGGG - Intronic
955415116 3:58684814-58684836 AGAAGTATTCGCTGTGGAAATGG - Intergenic
958790639 3:98647012-98647034 AGAAGAGTTCACGTTGGGAAGGG - Intergenic
959295698 3:104531432-104531454 AGGAGTAGTCACTCAGGGCAAGG - Intergenic
959438671 3:106349712-106349734 AGTAGTAATCACTGTGGGACAGG - Intergenic
960190103 3:114693709-114693731 AGGATGTTTCCCTTTGGGAATGG + Intronic
960266446 3:115625688-115625710 AGCTGTCTTCATTTTGGGAAGGG - Intronic
960929904 3:122836626-122836648 AGGAGCATTCCCTTTGAAAATGG + Intronic
962607458 3:137044625-137044647 GGGAGTGTTCACTTTGGAATTGG + Intergenic
962651939 3:137503788-137503810 AGGAGTTTTCACTATTGGAAAGG - Intergenic
963330310 3:143907063-143907085 AAAAGTATTCAGATTGGGAAGGG - Intergenic
964345114 3:155747173-155747195 AGAATTATTACCTTTGGGAAGGG - Intergenic
964421198 3:156505168-156505190 AGGAACATTCACTGGGGGAAAGG - Intronic
964597729 3:158455669-158455691 AGGAGACTTCACTTTGGAAGGGG + Intronic
965747847 3:171944154-171944176 AGGAATATTTACTTTGAAAAAGG - Intergenic
966018064 3:175167803-175167825 AGGAGGCTCCACTTTGGGCAAGG - Intronic
966603400 3:181797575-181797597 AGGAATATACACTTTGAGAGTGG + Intergenic
968262012 3:197333066-197333088 AAAAGTATTCATTTTGGGGAAGG - Intergenic
970654066 4:18212070-18212092 ATGAGTATGCATCTTGGGAATGG + Intergenic
970865843 4:20757709-20757731 AAGACTATACACTTTGGAAATGG + Intronic
971783513 4:31070092-31070114 AGGAAAATTCACTTTAGGCACGG - Intronic
972135553 4:35888560-35888582 AGGAGTATTGACTTTGTCAAGGG + Intergenic
975264752 4:72350131-72350153 AGCAGAAATCACTTTAGGAATGG - Intronic
975693715 4:76990946-76990968 ATGAGTTTTCTCTTTAGGAATGG + Intronic
975759333 4:77603621-77603643 AGGAGTATTTACTTTTGAAGTGG + Intronic
977789894 4:101087383-101087405 AAGGGTGTTCACTTTGTGAAAGG - Intronic
978129245 4:105174680-105174702 AGGAGGACTCACTTACGGAAGGG + Intronic
978911284 4:114066981-114067003 AATAGTCTTCACTTTGGGATGGG + Intergenic
980852076 4:138395321-138395343 ATGTGTATGCACCTTGGGAATGG - Intergenic
981736304 4:147955723-147955745 AGAAGTATTTAATTTGCGAAAGG + Intronic
982584950 4:157223831-157223853 AGGAATATTCATTTTGTCAATGG - Intronic
985448325 4:190040780-190040802 AGGCGTATTCACTATGTGAGGGG + Intergenic
991554431 5:67879413-67879435 ATAATTATTCACCTTGGGAAAGG - Intergenic
992829037 5:80576543-80576565 AGGATTAGTCATTTAGGGAAAGG + Intergenic
993834185 5:92796311-92796333 AAAAGTATTAATTTTGGGAACGG + Intergenic
994070251 5:95593166-95593188 AGGAAGATTTTCTTTGGGAATGG - Intronic
995067767 5:107881357-107881379 ATGATTATTCACTTTGCAAATGG - Intronic
996082546 5:119271641-119271663 AGGGGCATTGACTTTGGCAATGG + Intronic
998611179 5:143690814-143690836 AAGAGTAGACACTTTGGAAAGGG - Intergenic
998774911 5:145588387-145588409 AGGAGTTTTCTTTATGGGAAAGG - Intronic
1004149984 6:13107499-13107521 TGGAGTATTCTTTGTGGGAAGGG + Intronic
1005551563 6:26922959-26922981 AGGAGCAAACACTTTGGGGATGG + Intergenic
1006390274 6:33754277-33754299 AGGAGGATTAACTTGGGGAATGG + Intergenic
1006541087 6:34740493-34740515 AGGATTATTCTGCTTGGGAAAGG - Intergenic
1008853819 6:56057002-56057024 AGTATTAATTACTTTGGGAATGG - Exonic
1010157149 6:72808283-72808305 AGGAGTATTCACTTTGGGAATGG + Intronic
1010768813 6:79805544-79805566 TGCAGAATCCACTTTGGGAAAGG + Intergenic
1011848247 6:91592983-91593005 AGGGGTATTCAATTAGGAAAAGG + Intergenic
1011853671 6:91662449-91662471 AGGTGTCTTCATTTTGGCAAGGG - Intergenic
1012962021 6:105631958-105631980 ATGAGTATTCATTCTGGGCAGGG - Intergenic
1015353311 6:132247800-132247822 AGCAGTATAAACTTTGGGAGAGG + Intergenic
1016124047 6:140376757-140376779 AGGGGTATTAATTTTGGGATAGG + Intergenic
1016274210 6:142329602-142329624 ATGATTATTCACTAAGGGAAGGG - Intronic
1017947842 6:159110089-159110111 TGGAGAATTCAGTTTGGGAATGG - Intergenic
1020826636 7:13036943-13036965 AGGAGAATTCACTTTGAGTTAGG - Intergenic
1021464636 7:20928324-20928346 AAGAGAATTCTCTTAGGGAAGGG + Intergenic
1021796261 7:24257491-24257513 TGGATTTTTCACTTTGGAAAGGG + Intergenic
1025150019 7:56540427-56540449 TGGAGTTCTAACTTTGGGAAGGG - Intergenic
1026608088 7:71833079-71833101 AGGAGGAATCACTTTGGAGAAGG - Intronic
1027511122 7:79081405-79081427 TGGAGCATACACTTTGGCAAGGG - Intronic
1028201099 7:87962861-87962883 AGGATCATTCAGTTTAGGAAGGG + Intronic
1028403782 7:90454661-90454683 AGGACAATTCATTTTGTGAAGGG + Intronic
1029036592 7:97528947-97528969 AGGTGTATTCACTTTTTGTAGGG - Intergenic
1030579871 7:111341569-111341591 AGGAGCATTTACCATGGGAATGG - Intronic
1030745115 7:113155851-113155873 TGGAATTTTCCCTTTGGGAAGGG + Intergenic
1031918080 7:127581872-127581894 AGGAGTCTTCAATGTGGGAAGGG - Exonic
1034553643 7:151836561-151836583 AGGGGAATTCACACTGGGAAGGG - Intronic
1036558631 8:9883248-9883270 AGGTGTAGATACTTTGGGAATGG + Intergenic
1037145959 8:15573280-15573302 AGGATTATTCTGTTTGAGAAAGG + Intronic
1037527326 8:19739806-19739828 AGAAGTAGGCAATTTGGGAATGG - Intronic
1037544418 8:19904646-19904668 AACAGTGTTCATTTTGGGAAAGG + Intronic
1037766438 8:21775188-21775210 TGCACTCTTCACTTTGGGAAGGG - Intronic
1039579170 8:38650282-38650304 AGTCGTATTTGCTTTGGGAAAGG + Intergenic
1039617292 8:38966286-38966308 AGGAGGGGTCACTTTGGGGATGG + Intronic
1039977098 8:42376257-42376279 AGGACAGTTCACTTAGGGAAGGG - Intronic
1041287433 8:56274804-56274826 AAAAGTATTAATTTTGGGAATGG - Intergenic
1042719937 8:71816498-71816520 AGGAGTGTTCACTCTGGTTAGGG - Intergenic
1043458479 8:80436063-80436085 TGGAGCATAAACTTTGGGAAGGG - Intergenic
1044073203 8:87787715-87787737 AGTATTATTCACACTGGGAAGGG - Intergenic
1044153560 8:88814176-88814198 AAGAGTCTTCAATTTGGTAAAGG + Intergenic
1044768324 8:95601438-95601460 GGAAGTATTCTCTTTGAGAATGG + Intergenic
1046702411 8:117416425-117416447 AGGGGTGTTCACATTGGAAACGG - Intergenic
1046763635 8:118046673-118046695 AGGAGTTTTCAATTTTAGAAGGG - Intronic
1047314307 8:123718287-123718309 AGGAGTTTTCACCTTGTAAATGG + Intronic
1048021430 8:130542823-130542845 AGGAGTTTTCAATATGAGAAAGG - Intergenic
1048982050 8:139707711-139707733 AGGAATATCTACTTTGGGCAGGG - Intergenic
1051343235 9:16130044-16130066 TGGTGTATTCAATTCGGGAAGGG - Intergenic
1051426273 9:16934753-16934775 AGAAATATTCACTTTGGGCTGGG - Intergenic
1055753304 9:79530576-79530598 AAGAGCATTCACATGGGGAAGGG + Intergenic
1056549318 9:87638585-87638607 AGGTGTGGTCTCTTTGGGAAGGG + Intronic
1057134079 9:92674433-92674455 ATGTGTATTCACTTTGGGGGCGG + Intergenic
1057298798 9:93864743-93864765 AGGAGTATTCACCTAGGGGTGGG + Intergenic
1058201969 9:102054993-102055015 AGAAGTATTTACTTGGGGAGGGG + Intergenic
1059615274 9:115944029-115944051 AGGAGAATTAACTATGTGAATGG + Intergenic
1186293547 X:8124678-8124700 GGGATTATGCACATTGGGAAAGG - Intergenic
1186729321 X:12391814-12391836 AGGAGTATTAACTTTAGGCTTGG + Intronic
1187536647 X:20147042-20147064 AAGGGGATTCATTTTGGGAAAGG - Intergenic
1188114607 X:26227841-26227863 AGGAGTTAGAACTTTGGGAATGG + Intergenic
1188227311 X:27616281-27616303 AGGATTATTCACTATTGGAAAGG - Intronic
1188920563 X:35971491-35971513 AGCAATATGCACTATGGGAAAGG + Intronic
1189005250 X:36987340-36987362 AAGAGTCAACACTTTGGGAAAGG - Intergenic
1189043777 X:37570602-37570624 AAGAGTCAACACTTTGGGAAAGG + Intronic
1190274719 X:48892378-48892400 ATGAGTTTTCATTTTGGGATGGG - Intergenic
1191593183 X:62911968-62911990 AGCAGTATTCACTGTGGGTCTGG - Intergenic
1195476331 X:105289938-105289960 AGGAGTATTCAATCAGGCAAAGG + Intronic
1197496237 X:127185124-127185146 AAGAGTTCTTACTTTGGGAATGG - Intergenic
1199463812 X:148113606-148113628 AGCAGCATTAACTTTGGAAAAGG - Intergenic