ID: 1010158348

View in Genome Browser
Species Human (GRCh38)
Location 6:72821971-72821993
Sequence GGATGCACGAAGGATAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010158348_1010158352 13 Left 1010158348 6:72821971-72821993 CCTATCTTATCCTTCGTGCATCC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1010158352 6:72822007-72822029 CAGAAAGGCTGTCAGTTTCCTGG 0: 1
1: 0
2: 1
3: 26
4: 225
1010158348_1010158351 -2 Left 1010158348 6:72821971-72821993 CCTATCTTATCCTTCGTGCATCC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1010158351 6:72821992-72822014 CCTCTCTGTGACTCTCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010158348 Original CRISPR GGATGCACGAAGGATAAGAT AGG (reversed) Intronic
901699962 1:11039983-11040005 GGATGAATGAGGGATAGGATTGG + Intronic
903534642 1:24058866-24058888 GGATGCACGAAGGAACACAGAGG + Intronic
904276414 1:29387603-29387625 GTGTGCAAGAAGGATAAGAATGG + Intergenic
905520326 1:38594026-38594048 GGATGGACGGAGGATATGAAGGG + Intergenic
906550139 1:46658682-46658704 GGATTCACTAAGGACAAGGTAGG - Exonic
907166294 1:52414530-52414552 AGAAGCGTGAAGGATAAGATTGG + Intronic
914978574 1:152391052-152391074 GAATGCAGGAAGTATAGGATAGG - Intergenic
917589760 1:176463901-176463923 GGGTGCAGGAAGGAAAGGATGGG + Intronic
917831462 1:178894157-178894179 GGATGACCCAAGGATAAGAGGGG - Intronic
924275985 1:242387485-242387507 GGGTGGAAGAGGGATAAGATTGG + Intronic
924845734 1:247768019-247768041 GGATGAATGAAGGATAGTATAGG + Intergenic
1068599930 10:58946142-58946164 GGTTGCATGAGGGATAAGATGGG + Intergenic
1072886950 10:99285577-99285599 GGAGGAAGGAAGGATAAAATGGG + Intergenic
1073121535 10:101125122-101125144 GGAGACACGAAGGATGAGAGAGG + Intronic
1075428693 10:122363056-122363078 GGATGGATGAATGAGAAGATTGG - Intergenic
1076170715 10:128317455-128317477 GGATGCTTGATGGATAAAATTGG - Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1086151492 11:83615582-83615604 GGATCCACGAAGGATAATCCAGG - Intronic
1089208714 11:116786501-116786523 GCCTGCACGAAGGGTAAGCTGGG - Exonic
1098890023 12:76000607-76000629 GAATGCACAAATGATAAGAAAGG - Intergenic
1106345095 13:28868984-28869006 GCAAGCACGAAGGAGAAGGTTGG + Intronic
1112995924 13:105575259-105575281 GGATGCACAGAAGACAAGATTGG + Intergenic
1113602784 13:111582597-111582619 GGCTGCAGAAAGGATGAGATGGG - Intergenic
1114792654 14:25677358-25677380 GGATGCAGGAAGGAGATGAGGGG + Intergenic
1115320291 14:32073405-32073427 GGAAGAAGGCAGGATAAGATGGG - Intergenic
1122027993 14:98891665-98891687 GGATGCATGGAGGATGAGAGTGG - Intergenic
1126332289 15:47546278-47546300 GGATTCCCAAAGGATAAAATGGG - Intronic
1140873424 16:79127883-79127905 GACTGCAAGAAGGAGAAGATTGG + Intronic
1144111531 17:12039484-12039506 GGAGGGAAGAAGAATAAGATTGG - Intronic
1144237710 17:13278145-13278167 AGATGCACGAAGGGTTAGACTGG + Intergenic
1147810924 17:43169556-43169578 GGAAGCACTAAGGATCAGGTTGG - Intergenic
1156774287 18:40768589-40768611 GGAGGCATTAAGGAAAAGATTGG - Intergenic
1158405010 18:57153114-57153136 GGAGGAACGAAGGAGAAGAGTGG - Intergenic
1159670523 18:71215412-71215434 GTAAGCACCAAGGATAAGAGAGG - Intergenic
1160120295 18:76124373-76124395 GGATGCACAAAAGATAAAAATGG - Intergenic
1165086520 19:33352239-33352261 GGATGCAAGACACATAAGATAGG - Intergenic
1167849801 19:52192665-52192687 GGATGGATGAATGAAAAGATGGG - Intronic
1168139962 19:54379324-54379346 AGATGCAAGAAGGATTAGTTAGG - Intergenic
929364357 2:41134840-41134862 GGAAGCTAGAAGGATAAAATAGG - Intergenic
931878373 2:66539767-66539789 GGATGCTGGAAGGAGAACATGGG + Intronic
933756290 2:85641384-85641406 TGATGCAAGTAGGATAAGACAGG + Intronic
937690962 2:124754527-124754549 GGATGCATGAATGAAGAGATGGG + Intronic
938920759 2:135992495-135992517 GGATGGAGGAAGGATAAGAATGG + Intergenic
941036693 2:160576475-160576497 GGAAACTCTAAGGATAAGATAGG + Intergenic
944000576 2:194831343-194831365 GGAAGGAGGAAGGATAAGATTGG + Intergenic
945448797 2:209969835-209969857 TGAGGCAGGAAGGATATGATTGG - Exonic
946788745 2:223276673-223276695 GGATGGAGGAATGATAAGGTTGG + Intergenic
947029948 2:225782622-225782644 GGAGGGAGGAAGGGTAAGATAGG - Intergenic
947061202 2:226168195-226168217 GGATGAAGCAAGGATAAGATCGG - Intergenic
948296220 2:236862686-236862708 GGCTGCACGGAGGATAACAAAGG - Intergenic
1171305205 20:24099228-24099250 TGATACACGAAGGATGAGAAAGG - Intergenic
1173826216 20:46049390-46049412 GGATGACTGAAGGATAAAATAGG + Intronic
1174849159 20:53975217-53975239 GGACGCATGGAGGATAACATTGG - Intronic
1175535702 20:59709741-59709763 GGATGCATGAAGGACCTGATGGG + Intronic
1183087342 22:35494443-35494465 GGCTGCAAGGAGGATTAGATGGG - Intergenic
1183172033 22:36195444-36195466 GGAAACAAAAAGGATAAGATTGG + Intronic
951587777 3:24232876-24232898 GGATGCAGATAGGTTAAGATTGG + Intronic
960084633 3:113577280-113577302 GGAGGCACAAAGGTTAAGAACGG + Intronic
961929043 3:130514479-130514501 AGATGAATGAAGGAGAAGATTGG + Intergenic
963607864 3:147427775-147427797 GGATGGATGAAGGAGAAGTTTGG - Intronic
963810636 3:149773161-149773183 GGAGGCAAGAAGGAAAAGAGAGG - Intronic
977158347 4:93602899-93602921 GAATGCATGAATGATAAGACAGG + Intronic
981595779 4:146420063-146420085 GGACACAGGAAGGATGAGATTGG + Intronic
982437293 4:155393997-155394019 GGATGCAGGAAAGAAAAGAGAGG - Intergenic
986491385 5:8294622-8294644 AGATGCACGAAGGATGTGAAGGG - Intergenic
992530008 5:77644725-77644747 AGATGCAAGGAGGAAAAGATAGG - Intergenic
1001186755 5:169581558-169581580 GGATTCACCAAGCATAGGATGGG - Intergenic
1003163807 6:3658765-3658787 GCAGGCAGGAAGGTTAAGATGGG + Intergenic
1005016211 6:21377695-21377717 GGATACACGCAGGGTAAGAATGG + Intergenic
1006354587 6:33547425-33547447 CGATGAAGGAAGGTTAAGATGGG - Intergenic
1008547666 6:52597797-52597819 GGATGAAAGATGGATAAGAAGGG - Intergenic
1010158348 6:72821971-72821993 GGATGCACGAAGGATAAGATAGG - Intronic
1010938685 6:81890034-81890056 GGATGAAGGAAGTTTAAGATGGG - Intergenic
1018381246 6:163260069-163260091 GGAGGCACCAAGGATAAGCCAGG - Intronic
1022552399 7:31253359-31253381 GGCTGCAGGGAGGATCAGATGGG + Intergenic
1025621530 7:63176066-63176088 GTATGCAGGAAGGAGAATATGGG - Intergenic
1028310931 7:89334854-89334876 AGATGTAGGAAGGAAAAGATAGG - Exonic
1030164181 7:106536357-106536379 GGATGCAAGAAGGTTATGATCGG + Intergenic
1037832257 8:22196586-22196608 GGATGCAGTAAGGAGAAGATGGG - Intronic
1038123501 8:24644605-24644627 TGATGCACATAGGATGAGATAGG - Intergenic
1038440771 8:27569574-27569596 GGATGGATGAAGGACTAGATGGG + Intergenic
1042454095 8:68979487-68979509 GGATGGACGAAGAATAAGACTGG + Intergenic
1043811530 8:84748355-84748377 GGATGAAAGATGGATAAGATAGG + Intronic
1044327598 8:90877315-90877337 GGATGCACTAAGGATGATTTGGG - Intronic
1048231184 8:132643432-132643454 GGAGGCAGGTAGGATAAGAAAGG + Intronic
1049133903 8:140876187-140876209 GGATGCAAGATGGAAAAAATTGG - Intronic
1049153664 8:141053995-141054017 GGATGGATGAAGGAACAGATGGG + Intergenic
1049978472 9:882415-882437 GGATGTATAAAGGATAAGAAAGG - Intronic
1051977375 9:22967632-22967654 GGATTCAGGAAGGACCAGATGGG + Intergenic
1056027419 9:82513463-82513485 GTTGGCACGCAGGATAAGATAGG + Intergenic
1057901798 9:98954923-98954945 GGATGAATGAAGGAGAAGAGTGG - Intronic
1188979771 X:36716568-36716590 GGGTGCAGCAAGAATAAGATAGG + Intergenic
1189956373 X:46278658-46278680 GAAAGCAAGAAGGGTAAGATAGG - Intergenic
1199861277 X:151802077-151802099 GCAAGCAAGAAGGATAAGCTTGG - Intergenic
1201577146 Y:15473123-15473145 GGATGCATGAGGGATGTGATTGG + Intergenic