ID: 1010160266

View in Genome Browser
Species Human (GRCh38)
Location 6:72845988-72846010
Sequence GAGGTTAGGAAGCCTGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 0, 2: 4, 3: 99, 4: 564}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010160258_1010160266 30 Left 1010160258 6:72845935-72845957 CCACTGCTAATGTTATAGCCATT 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1010160266 6:72845988-72846010 GAGGTTAGGAAGCCTGTTCAGGG 0: 1
1: 0
2: 4
3: 99
4: 564
1010160260_1010160266 12 Left 1010160260 6:72845953-72845975 CCATTTCTACTCAGATGAGGAGA 0: 1
1: 0
2: 0
3: 31
4: 223
Right 1010160266 6:72845988-72846010 GAGGTTAGGAAGCCTGTTCAGGG 0: 1
1: 0
2: 4
3: 99
4: 564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010160266 Original CRISPR GAGGTTAGGAAGCCTGTTCA GGG Intronic
900009460 1:92611-92633 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900025570 1:269187-269209 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900035333 1:402960-402982 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900056954 1:638713-638735 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
901768341 1:11517904-11517926 GAGGTTGGGCAGCTTTTTCAAGG + Intronic
901867155 1:12114172-12114194 GAGGTTAGGAAACCTGCTTGAGG - Intronic
902133115 1:14280922-14280944 GAGGTTAAGCAGCCTGTCCAAGG + Intergenic
902297110 1:15475174-15475196 GAGGCTGAGAAGCCTGTTCTAGG - Intronic
902323965 1:15686383-15686405 GAGGTTAATAAGCCTGACCAAGG - Intronic
902447319 1:16475658-16475680 GAGGTTGGGCAGCTTGTCCAAGG + Intergenic
902467175 1:16625608-16625630 GAGGTTGGGCAGCTTGTCCAAGG + Intergenic
902538726 1:17137169-17137191 GAGGTTAGGTAACTTGTGCAAGG - Intergenic
902689683 1:18102663-18102685 GAGATCAGGAGGCTTGTTCAGGG + Intergenic
902971127 1:20051797-20051819 CAGGTCAGGAACCCTGTACAGGG - Intronic
903188735 1:21644410-21644432 GAGGTTAAGTAACCTGTTCAAGG - Intronic
903374230 1:22855824-22855846 GAGGTTAGGTAACTTGCTCATGG + Intronic
903476342 1:23621503-23621525 GAGGTTAGGTAGCTTGCCCAAGG + Intronic
904049169 1:27627948-27627970 GAGGTTTGGAAACCTGCCCAGGG + Intronic
904052385 1:27647505-27647527 GAGTTTATGCAGCTTGTTCAAGG - Intergenic
904239675 1:29135576-29135598 GAGTTTAAGTAGCTTGTTCAAGG + Intergenic
904422988 1:30405997-30406019 GAGGTTAGGCAGCCTGCCCAAGG + Intergenic
904900105 1:33850367-33850389 GAGGTAAAGAAACTTGTTCATGG + Intronic
904955688 1:34281750-34281772 GAGGCTAGGAAGCCAGGTCAGGG - Intergenic
905059590 1:35128274-35128296 CAGGTCAGGAACCCTGTACAGGG + Intergenic
905218118 1:36424496-36424518 GAGGTTAAGATGCCTCCTCAAGG + Intronic
905835916 1:41120773-41120795 GAGGCTAAGAAACTTGTTCATGG + Intronic
906410614 1:45575901-45575923 CAGGTCAGGAACCCTGTACAGGG + Intergenic
907719919 1:56962160-56962182 GAGATTTGAAAGCCTGTTAATGG + Intronic
907792598 1:57682003-57682025 GATGTTCGGAAGCCTATTAAGGG - Intronic
908512751 1:64862327-64862349 GAGGTTAAGTAACCTGTCCAAGG - Intronic
908758267 1:67488913-67488935 GACGTTAGGTAACATGTTCAAGG + Intergenic
908862876 1:68509482-68509504 CAGGTCAGGAACCCTGTACAGGG + Intergenic
909475012 1:76072869-76072891 GAGGTTAAGAAACTTGATCAAGG + Intergenic
909834029 1:80231168-80231190 GAGGCTAGGAAGCCTCTGCTTGG - Intergenic
910386974 1:86694393-86694415 CAGGTTAGGAACCCTGTGCGGGG + Intergenic
910626695 1:89314864-89314886 TAGGTCAGGAACCCTGTACAGGG + Intergenic
911576851 1:99588192-99588214 CAGGTCAGGAACCCTGTACATGG + Intergenic
912146477 1:106799984-106800006 GAGGTTATGTAACTTGTTCAAGG + Intergenic
912407708 1:109454399-109454421 CAGGTTAGGAACCCTGTACAGGG + Intergenic
913251832 1:116918276-116918298 GAGGTTAGAAAACCTGTCCAAGG - Intronic
913692718 1:121294429-121294451 GAGGGTAGGAAGCCTTTCTAGGG + Intronic
914144838 1:144985661-144985683 GAGGGTAGGAAGCCTTTCTAGGG - Intronic
915049669 1:153055296-153055318 GAGGCAAGGAAGGGTGTTCAGGG + Intergenic
915318833 1:155044855-155044877 GAGGTTAGGGAGCCTGGCCCGGG + Intronic
915565413 1:156710205-156710227 GGGGTTAAGAAGCCAGTGCAGGG - Intergenic
916813834 1:168331224-168331246 GAGGTTAAGAAACTTGTTTAAGG + Intergenic
916954404 1:169816718-169816740 CAGGTAAGGAACCCTGTACAGGG + Intronic
917077026 1:171216032-171216054 CAGGTCAGGAACCCTGTACAGGG + Intergenic
917791618 1:178502826-178502848 GAGGTTAAGAAACCTGCCCAAGG + Intergenic
918449042 1:184641514-184641536 GAGGTTAGACAGCCTGATCAAGG - Intergenic
918763789 1:188451077-188451099 AAGGTTAAGAAGCTTGTCCAGGG + Intergenic
919350509 1:196447456-196447478 GTGGTGAGGAAGCCTATTGAAGG + Intronic
919540533 1:198839688-198839710 GAGATTAGAAAGACTGTACATGG + Intergenic
919688704 1:200508838-200508860 GAGGTTAAGCAACGTGTTCAAGG - Intergenic
920421241 1:205835312-205835334 GAGGTTAAGAAGCTTGTCCAAGG - Intronic
920480039 1:206312790-206312812 GAGGGTAGGAAGCCTTTCTAGGG + Intronic
920594047 1:207250751-207250773 CATGTTAGGAAGCCAGGTCAAGG + Intergenic
920640396 1:207746538-207746560 CAGGTTAGGAACCATGTGCAGGG - Intergenic
920724030 1:208416757-208416779 GAAGCTAAGAAGCCTGTCCAAGG + Intergenic
920930766 1:210385910-210385932 AAGGTTAAGAATCATGTTCAAGG + Intronic
921404706 1:214765686-214765708 GAAGCTAGGAAGCCTGCACAGGG - Intergenic
921535852 1:216348380-216348402 CAGGTCAGGAACCCTGTACAGGG - Intronic
921680173 1:218022007-218022029 CAGGTCAGGAACCCTGTGCAGGG - Intergenic
921684544 1:218074989-218075011 GAGGCTAAGAAACCTGTCCAAGG - Intergenic
921934662 1:220786015-220786037 AAGGTAAGGAAGACTATTCAAGG - Intergenic
922257865 1:223908520-223908542 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
922455072 1:225767917-225767939 GAAGTTAGGAAGCTTTTTAAAGG + Intergenic
922543385 1:226435580-226435602 GAGGTCAGGAAGCCAGGTCTGGG - Intergenic
923394042 1:233543277-233543299 GAGGAGAGGAAACCTGTTGAAGG - Intergenic
923680436 1:236114210-236114232 GAGGTCAGGAAGCAGGTTCTGGG + Intergenic
924339062 1:243011299-243011321 GAGGTTAGGTCACTTGTTCAAGG - Intergenic
924579345 1:245310494-245310516 GAGCTTAGGAAACTCGTTCAAGG + Intronic
924846887 1:247783359-247783381 GAGGTAAGGAAGAGTATTCATGG - Intergenic
924920392 1:248623048-248623070 GAGGTTAGGTAACATGCTCAGGG + Intergenic
1063126226 10:3138738-3138760 GATGTCAGGAAGCGTGTTTAGGG + Intronic
1064392946 10:14957248-14957270 GAGGTTAAGTAGCTTGTCCAGGG + Intergenic
1064541529 10:16410806-16410828 GTGGTTAAGAAGACTATTCATGG + Intergenic
1065703105 10:28444494-28444516 GAGGTTAGGTAACCTGGGCAAGG - Intergenic
1065943518 10:30586608-30586630 AAGGTCAGGAACCCTGTACAGGG + Intergenic
1065961610 10:30738442-30738464 GAGGTTAGAAAACCTGCTCAAGG - Intergenic
1068473839 10:57500175-57500197 CAGGTTAGGAATTCTGTACAGGG - Intergenic
1068632737 10:59314417-59314439 GAGGTTAGGGAATCTGTCCAAGG + Intronic
1068808959 10:61234061-61234083 CAGGTTAGAAACCCTGTACATGG - Intergenic
1068874414 10:61981070-61981092 GAGATTAAGCAACCTGTTCAAGG - Intronic
1068935511 10:62632163-62632185 GGGGTCAGGAAACTTGTTCAAGG + Intronic
1069944294 10:71975290-71975312 GAGGTTAGGCAACTTGTCCAAGG + Intronic
1070726561 10:78795478-78795500 GAGGTTAAGTAGCTTGCTCAAGG - Intergenic
1071423578 10:85526211-85526233 GAGGTTAGGAAACATGTCTATGG + Intergenic
1071437510 10:85660896-85660918 GAGGTTAGGTAGCTTATCCACGG - Intronic
1072717715 10:97762690-97762712 GAGGTTAGGGAACCTGCCCAAGG + Intergenic
1073437583 10:103529433-103529455 CAGGTGAGGAACCCTGTACAGGG + Intronic
1073574471 10:104610968-104610990 CAGGTCAGGAACCCTGTACAGGG - Intergenic
1073903424 10:108249529-108249551 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1074445598 10:113518906-113518928 GAGGTTAGGAAACCTGCCTAAGG + Intergenic
1075416669 10:122269369-122269391 GGGGTTAGGAACCCAGTTCAGGG - Intergenic
1075896454 10:125999683-125999705 GAGGTTAGGTAGCCTGCCCAAGG - Intronic
1076164739 10:128272689-128272711 GAGGGAAGGGAACCTGTTCATGG + Intergenic
1076695343 10:132244599-132244621 GAGGTTGGGAAGCCTGGGCCCGG - Intronic
1077521545 11:3038409-3038431 GAGGTTAGGTGCCCTGTCCAGGG - Intronic
1077534631 11:3117265-3117287 CAGGTCAGGAACCCTGTACAGGG - Intronic
1078742332 11:14078659-14078681 CAGATTAGGTAACCTGTTCAAGG - Intronic
1079060618 11:17245695-17245717 GAGGTTAGGCATCCTGCTCAAGG - Intronic
1079247492 11:18763408-18763430 GAGCTTAGGCAGTCTGTCCAAGG - Intronic
1079257635 11:18846307-18846329 GAGGTTAAGAAACTTGTCCAAGG + Intergenic
1079947856 11:26766000-26766022 CAGGTTAGGAACCCTGCACAAGG - Intergenic
1080666722 11:34342801-34342823 GAGGTTTGGTAGCTTGCTCACGG - Intronic
1080686135 11:34516439-34516461 GAGGTTAAGTAACTTGTTCACGG + Intergenic
1080850099 11:36060955-36060977 GTGGTTAGGTAACCTGTCCAGGG - Intronic
1081683501 11:45025387-45025409 GAGGTTAAGAAACCTGTCTAAGG - Intergenic
1082228517 11:49736828-49736850 CAGGTTAAGAAACCTGTCCAGGG + Intergenic
1082343248 11:51393997-51394019 GAGGTGAACAATCCTGTTCATGG + Intergenic
1082353383 11:51540897-51540919 GAGGTGAAGAATCCTGTTGATGG + Intergenic
1082356815 11:51591048-51591070 GAGGTGAGCAATCCTGTTGATGG + Intergenic
1082358390 11:51613998-51614020 GAGGTGAAGAATCCTGTTGATGG + Intergenic
1082363913 11:51694771-51694793 GAGGTGAAGAATCCTGTTGATGG + Intergenic
1082371236 11:51801035-51801057 GAGGTGAAGAATCCTGTTGATGG + Intergenic
1082374229 11:51844391-51844413 GAGGTGAAGAATCCTGTTGATGG + Intergenic
1082414443 11:52427821-52427843 GAGGTGAAGAATCCTGTTGATGG + Intergenic
1082417984 11:52478819-52478841 GAGGTGAAGAATCCTGTTGATGG + Intergenic
1082421743 11:52533231-52533253 GAGGTGAACAATCCTGTTCATGG + Intergenic
1082430307 11:52657318-52657340 GAGGTGAAGAATCCTGTTGATGG + Intergenic
1082433791 11:52707473-52707495 GAGGTGAAGAATCCTGTTGATGG + Intergenic
1082446093 11:52885106-52885128 GAGGTGAGCAATCCTGTTGATGG + Intergenic
1082451018 11:52956517-52956539 GAGGTGAACAATCCTGTTCATGG + Intergenic
1082464973 11:53158836-53158858 GAGGTGAAGAATCCTGTTGATGG + Intergenic
1082491410 11:53539502-53539524 GAGGTGAAGAATCCTGTTGATGG + Intergenic
1082498971 11:53649157-53649179 GAGGTGAACAATCCTGTTCATGG + Intergenic
1082535244 11:54174432-54174454 GAGGTGAAGAATCCTGTTGATGG + Intergenic
1082535420 11:54176984-54177006 GAGGTGAAGAATCCTGTTGATGG + Intergenic
1082801869 11:57420806-57420828 GAGGTTAAAAAGCTTGTTGAAGG - Intronic
1083358860 11:62091007-62091029 AAGGTCAGGAACCCTGTACAGGG - Intergenic
1084678336 11:70649918-70649940 GAGATTAAGAAGCCTGCCCAGGG - Intronic
1084875177 11:72126042-72126064 CAGGTTAGGAACCCTGTCCAGGG + Intronic
1085534085 11:77207794-77207816 GAGGTTAGGTAACTTGTCCAAGG + Intronic
1085573687 11:77583458-77583480 CAGGTCAGGAACCCTGTACAGGG - Intronic
1086119970 11:83295443-83295465 GGGGTTAAGTAGCTTGTTCAGGG + Intergenic
1086563052 11:88190766-88190788 GAGGTTAAGAATCATGCTCATGG - Intergenic
1087432051 11:98067155-98067177 CAGGTCAGGAACCCTGTACAGGG + Intergenic
1088053109 11:105542650-105542672 GAAGTTAAACAGCCTGTTCATGG - Intergenic
1088591155 11:111404459-111404481 GTGGTTAGGAAGCATTTTCTAGG + Intronic
1088594428 11:111429390-111429412 GAGGTTAAGCAGCCTGCTCAAGG + Intronic
1088623478 11:111710750-111710772 GAGGTTAGGAAACCTGATTAAGG + Intronic
1089738597 11:120566302-120566324 GACGTTAGGCACCCTGTCCAGGG + Intronic
1090455732 11:126848042-126848064 CAGGTCAGGAACCCTGTACAGGG - Intronic
1090596206 11:128323642-128323664 GAGGTTAAGGAGCTTGCTCAAGG - Intergenic
1090654267 11:128830955-128830977 GAGGTTAAGATGCATGCTCATGG - Intergenic
1090766854 11:129883780-129883802 GAGGTTAGGGAGCTTGTCCTTGG - Intronic
1090985254 11:131760807-131760829 GAGCTAAGGAAACCTGTTCCAGG + Intronic
1091674293 12:2477560-2477582 GAGATGAGGCAGCCTGTTGATGG - Intronic
1091971780 12:4793598-4793620 GAGGTTAAGGAGCATGCTCAGGG + Intronic
1092585905 12:9900716-9900738 CAGGTCAGGAACCCTGTACAGGG + Intronic
1093645958 12:21585415-21585437 GAGGTAAGGAAGCGTATGCATGG + Intronic
1094491489 12:30963630-30963652 GAGGTTAGGAGACTTGTCCAAGG - Intronic
1094749545 12:33389949-33389971 GAGGTTAAGTAGCTTGTTCAAGG - Intronic
1096571238 12:52524510-52524532 GAGGTTAGGCAACTTGCTCAGGG - Intergenic
1097338732 12:58413855-58413877 CAGGTCAGGAACCCTGTACAGGG + Intergenic
1097499983 12:60389715-60389737 GAGGTCAGGAACCCTGTACAGGG + Intergenic
1097601477 12:61698474-61698496 CAGGTTAGGAACTCTGTACAGGG - Intergenic
1097695415 12:62770341-62770363 GAGGTTAGGCATTTTGTTCAAGG + Intronic
1098471972 12:70855610-70855632 GAAGCTAGGAAGCTTGCTCAAGG - Intronic
1099700646 12:86077797-86077819 GAGGTAAGGAAGAGTGTGCATGG - Intronic
1100168157 12:91941561-91941583 GAGGTTAAGTAACCTGTCCAAGG - Intergenic
1100394566 12:94173601-94173623 GAGGTTAGGTATCTTTTTCAAGG + Intronic
1100927774 12:99569374-99569396 GAGTTTAGGTAGCTTGTCCAAGG - Intronic
1101383235 12:104232591-104232613 CAGGTTAGGAACCCTGTGCGGGG + Intronic
1101519995 12:105473455-105473477 AAGGTTAAAAAGCATGTTCAAGG + Intergenic
1101752301 12:107591870-107591892 GAGGTTAAGAAACCTGCCCACGG + Intronic
1101819395 12:108172188-108172210 GAGGTTAGGTAACTTGTTCAAGG + Intronic
1101822273 12:108193080-108193102 GAGATTAGGTAACTTGTTCAGGG - Intronic
1101944440 12:109125751-109125773 GAGGTGAGGAAACTTGTTCAAGG + Intronic
1101993628 12:109508303-109508325 GAGGTTAAGAAACTTGCTCAGGG - Intronic
1102755792 12:115339155-115339177 GAGGTCAAGCAGCCTGTCCAAGG + Intergenic
1103978648 12:124721181-124721203 GAGGTTAGGTAACTTGCTCAAGG - Intergenic
1104030379 12:125061163-125061185 CAGGTCAGGAATCCTGTACAGGG + Intergenic
1104223635 12:126810429-126810451 GAAGTTAGGAAGCCAGTGCGTGG + Intergenic
1105051065 12:133051555-133051577 GAGCTTAGGAAGCCTGCACATGG - Intronic
1106623214 13:31391154-31391176 CAGGTTAGGAACCCTGTGCAGGG + Intergenic
1106716200 13:32390951-32390973 GAGGTTAAGTAGCCTGCTCAGGG + Intronic
1107355128 13:39558235-39558257 GAGGTTAGGTGACCTGTCCAAGG - Intronic
1108072484 13:46642398-46642420 GAGGTTAGGTAACTTGTCCAAGG - Intronic
1108208927 13:48118630-48118652 GAGGTGAGGAAACTTGCTCAAGG - Intergenic
1108508105 13:51131443-51131465 CAGGTCAGGAAACCTGTACAGGG - Intergenic
1109865574 13:68259535-68259557 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1110256902 13:73443127-73443149 CAGGTCAGGAACCCTGTACAGGG - Intergenic
1110362477 13:74643028-74643050 GAGGTTGGGAAGCCTCTTCTTGG + Intergenic
1110373455 13:74765675-74765697 GAGGTTAAGAAACTTGTCCAAGG + Intergenic
1111028747 13:82568904-82568926 CAGGTTAGGAACCCTGTACAGGG + Intergenic
1112273983 13:97998762-97998784 GAGGTTATGTAGCCAGTTAATGG + Intronic
1112655017 13:101442883-101442905 GAGGTTAAGAAACCTGGCCAAGG + Intergenic
1113094843 13:106652704-106652726 GAGGTGGGGAAACCTGTTAATGG + Intergenic
1113524342 13:110962707-110962729 CAGGTCAGGAACCCTGTACAGGG - Intergenic
1114689602 14:24568111-24568133 GAGTTTAGAAACCCTGTTTAAGG + Intergenic
1114845969 14:26322322-26322344 GAAGTTAGGAAGTCTCTTCCAGG + Intergenic
1115894029 14:38063787-38063809 GTGCTGAGGAAGCTTGTTCAGGG + Intergenic
1117191146 14:53293133-53293155 GAGGCTAAAAAGCCTGTTCAAGG - Intergenic
1117505610 14:56399740-56399762 GAGGTTCAGAAACCTGTCCAAGG + Intergenic
1117855605 14:60028915-60028937 GAGTTCAGGAAGCCTTTTCTGGG + Intronic
1118123328 14:62870851-62870873 GAGGATAGGTTGCTTGTTCAAGG + Intronic
1118535543 14:66759286-66759308 CAGGTTAGGAACCCTGTATAGGG + Intronic
1118938762 14:70313206-70313228 CAGGTCAGGAACCCTGTACAGGG - Intergenic
1118999301 14:70866776-70866798 CAGGGTAGGAACCCTGTACAGGG + Intergenic
1120912993 14:89684571-89684593 CAGGTCAGGAACCCTGTACAGGG - Intergenic
1120913292 14:89687581-89687603 GAGCTTCGGCAGCCTGTCCATGG - Intergenic
1120945887 14:89996656-89996678 GAGGTTAAGAAACTTGTCCAAGG - Intronic
1121003994 14:90475797-90475819 CAGGTCAGGAACCCTGTACAGGG - Intergenic
1121388478 14:93552899-93552921 TAGGTCAGGAACCCTGTACAAGG + Intronic
1121483441 14:94295492-94295514 GAGGTTAGGTAGCTTGTTCAGGG - Intergenic
1121818802 14:96949328-96949350 GAGGTTAAGTAGCTTGTCCAAGG + Intergenic
1121896462 14:97652654-97652676 GAGTTTAGGAAGCTGGTTCCTGG - Intergenic
1122186510 14:100001743-100001765 CAGGTCAGGAACCCTGTACAGGG + Intronic
1122223588 14:100258690-100258712 GAGGTTAAGTAACCTGCTCAGGG - Intronic
1122541618 14:102500909-102500931 GAGGTTAGGTAACTTGCTCAAGG + Exonic
1123478196 15:20607417-20607439 TACGTTAGGAACCCTGTACAGGG - Intergenic
1123639819 15:22392968-22392990 TACGTTAGGAACCCTGTACAGGG + Intergenic
1123766085 15:23479723-23479745 CAGGTCAGGAACCCTGTACAGGG - Intergenic
1123832066 15:24149701-24149723 CAGGTCAGGAACCCTGTACAAGG + Intergenic
1123846316 15:24305827-24305849 CAGGTCAGGAACCCTGTACAAGG + Intergenic
1126090917 15:45050508-45050530 CAGTTTAGGAATCCTGTACAGGG + Intronic
1126548675 15:49903014-49903036 GATGTTAGGAAGACAGTTTAAGG - Intronic
1126624047 15:50668997-50669019 CAGGTCAGGAACCCTGTACAGGG - Intronic
1126667257 15:51086621-51086643 GAGGTTAAGTAACCTGCTCAGGG - Intronic
1126947798 15:53843551-53843573 GAGATTAGTAATGCTGTTCAAGG + Intergenic
1127639964 15:60907196-60907218 GAGGTGAAGCAGCTTGTTCAGGG + Intronic
1129199363 15:73989724-73989746 GAGGCAAAGAAACCTGTTCAAGG + Intronic
1129272437 15:74426369-74426391 GAGGTCAGGGAGCATGTGCAGGG - Intronic
1129567500 15:76638946-76638968 CAGGTTAAGAAGCTTGCTCAAGG + Intronic
1129657685 15:77535243-77535265 GAGGTTAGGAAGCTTATTCAAGG + Intergenic
1131695960 15:94877734-94877756 CAGGTTAGGAACCCTGTACAAGG + Intergenic
1132037941 15:98502107-98502129 AAGGTTAAGAAACCTGCTCAAGG + Intronic
1133970997 16:10567932-10567954 GAGGTTAGGTAGCTTGTCAAAGG + Intronic
1134346404 16:13395897-13395919 GAGTTTAGGTAACGTGTTCAGGG + Intergenic
1134686496 16:16162365-16162387 GAGGTTTGGAAACTTGTCCAGGG - Intronic
1134880703 16:17743332-17743354 GAGGTTAAGAAACCTGCCCAAGG - Intergenic
1135036390 16:19081434-19081456 CAGGTTAGGAGCCCTGTACAAGG - Intergenic
1135486831 16:22872984-22873006 AAGGTTAAGAAACTTGTTCATGG - Intronic
1136559564 16:31031126-31031148 GAGGTTAGGAAGGATGTGGAAGG - Intergenic
1137598220 16:49738759-49738781 GAGGTGGGGAAGCCTTTCCAGGG - Intronic
1138038849 16:53639657-53639679 GAGGTTAAGTAACTTGTTCATGG - Intronic
1138435530 16:56997473-56997495 GAGGTTAAGAAAACTGTCCAAGG + Intronic
1139204899 16:65018228-65018250 CAGGTTAGGAACCCTGTGCAGGG + Intronic
1139292849 16:65873864-65873886 ATGGTTAGGAAGCCTGTCCCAGG - Intergenic
1140456502 16:75108892-75108914 GAGGTTAGGAAGCTTGTAGGAGG - Exonic
1141041501 16:80676421-80676443 GAGGTCAGGAAGGGTGTTCCCGG - Intronic
1141775329 16:86119128-86119150 GAGGGTAGGTAGCCTGCCCAGGG + Intergenic
1142454870 16:90214289-90214311 GAGGTTAGGTAACTTGTTCGAGG + Intergenic
1142868260 17:2804402-2804424 GAGTTTAGGAAACCCGTTCAAGG + Intronic
1144357951 17:14463566-14463588 GATGTTAGTAAGCTTGTTGAAGG - Intergenic
1144458541 17:15438642-15438664 AAGGTTAAGAAACTTGTTCAAGG - Intronic
1144593440 17:16544709-16544731 CAGGTTAGGAATCTTGTGCAGGG - Intergenic
1145101970 17:20085050-20085072 CAGGCTGGGAAGCCTGTTCTGGG + Intronic
1146039301 17:29435608-29435630 CAGGTCAGGAACCCTGTACAAGG + Intronic
1146464390 17:33074708-33074730 GAGGTTAAGAAACCTGCTAAAGG - Intronic
1146496373 17:33326047-33326069 GAGGTTAAGAAACTTGGTCAAGG + Intronic
1146672863 17:34754002-34754024 GAGATTCGGAAACCCGTTCAAGG + Intergenic
1146794060 17:35769156-35769178 GAGGTTAGGTAACTTGCTCAGGG - Intronic
1147008661 17:37425483-37425505 GAGGTTAAGTAACTTGTTCAGGG + Intronic
1147155722 17:38543714-38543736 GAGGTTGGGAAAGCTGGTCACGG + Intronic
1147513369 17:41093434-41093456 CAGGTCAGGAACCCTGTACAGGG - Intronic
1147515461 17:41113729-41113751 CAGGTCAGGAACCCTGTACAGGG - Intergenic
1147657089 17:42097211-42097233 GAGGTTAAGAAACTTGTTCAAGG + Intergenic
1149254246 17:54806858-54806880 GAGGTAAGAAAGACTCTTCAAGG - Intergenic
1149641784 17:58207435-58207457 GAGGTTAAGAAACCTGTCCTGGG - Intronic
1149778897 17:59380654-59380676 GAGGTTAATGAGCTTGTTCAAGG + Intronic
1151184235 17:72351552-72351574 GAGGTTAGGTAACCTGGCCAGGG - Intergenic
1152476348 17:80520968-80520990 GAGGTTGGGTAACCTGCTCAAGG + Intergenic
1153089964 18:1331918-1331940 GAGGTAAGGAAGAATGCTCATGG + Intergenic
1153992762 18:10414708-10414730 GATGTGAGGAAGCCTTTACAGGG - Intergenic
1156098320 18:33562934-33562956 CAAGTTAGGAACCCTGTACAGGG + Intergenic
1156247985 18:35321549-35321571 CAGGTCAGGAACCCTGTGCAGGG - Intergenic
1156569521 18:38237458-38237480 GAGGTTAGGCAACATGCTCAAGG + Intergenic
1156972083 18:43169115-43169137 CAGGTCAGGAACCCTGTACAAGG - Intergenic
1157661744 18:49451440-49451462 AAGGTTAGGAACCCTGTGCGGGG - Intronic
1157821952 18:50778458-50778480 CAGGTCAGGAACCCTGTACAGGG - Intergenic
1158453253 18:57585876-57585898 GAGGTTAGGTGCCTTGTTCAAGG + Intronic
1159628512 18:70722188-70722210 GAGGTTAGAAAGCCTATTGGCGG + Intergenic
1161277229 19:3425297-3425319 GAGGTTAAGGGGCCTGTCCAGGG + Intronic
1161423615 19:4189830-4189852 GAGGTTAAGACACCTGCTCAAGG + Intronic
1162324605 19:9991709-9991731 GAGGTTGGGAAGCCTGGTCACGG + Intronic
1163258016 19:16169488-16169510 GAGGTTAAGACACTTGTTCATGG - Intronic
1163270285 19:16248837-16248859 GAGGGCAAGGAGCCTGTTCAAGG - Intergenic
1163768815 19:19178510-19178532 GAGGTAAGGCAGCCAGCTCAGGG - Intronic
1164106522 19:22111239-22111261 CATGTTAGGAACCCTGTACAGGG + Intergenic
1164567374 19:29336963-29336985 GAGGTTAAGAAACTTGTCCAAGG - Intergenic
1165779014 19:38421321-38421343 GAGGTTAGGTTGCCTGTCCAAGG - Intronic
1167135128 19:47611078-47611100 GAGGTTAAGAAGCTTGCCCAGGG + Intronic
1167300545 19:48675032-48675054 GAGGTTAAGAAGCTTGTTCTCGG - Intergenic
925726215 2:6875061-6875083 GAGGCTAGGAAGCCAAATCAAGG - Intronic
926048564 2:9728264-9728286 GAGGTTAGGCAACTTGTCCATGG + Intergenic
926232343 2:11013712-11013734 GAGGTTATGTAGCCTGCCCAAGG - Intergenic
926927331 2:18000960-18000982 CAGGTTAGGAACCCTGTGCAGGG - Intronic
927498296 2:23564972-23564994 GAGGTTAGGTAACCTGTCCAGGG - Intronic
927870982 2:26623617-26623639 GAGGTTTGGAAACCTGCCCAAGG - Intronic
927875544 2:26653046-26653068 GAGGTTGGGCTGCCTGTGCAAGG - Intergenic
928099812 2:28430233-28430255 GAGGTTAAGTAACGTGTTCAAGG - Intergenic
928434863 2:31248450-31248472 GAGGCCAGGAGGCCTGTACATGG - Intronic
929957551 2:46470235-46470257 GGGGTGAGGAAGGCTGTTGATGG + Intronic
933131125 2:78674973-78674995 CAGGTCAGGAACCCTGTACAGGG + Intergenic
933763777 2:85693859-85693881 GAGGCTGGGAAGCCTCTCCAAGG - Intronic
933777834 2:85781937-85781959 GAGGTTAAGTATCCTGCTCAGGG + Intronic
934030948 2:88046268-88046290 GAGGTTAAGAAGCTTGACCAGGG - Intronic
934047289 2:88183132-88183154 GGGGTTTGGAAGTCTGGTCAAGG + Intronic
934048291 2:88189979-88190001 GAGGTTAGGTAACTTGTCCAAGG + Intergenic
934104649 2:88684646-88684668 CAGGTCAGGAACCCTGTACAGGG - Intergenic
935377325 2:102412775-102412797 CAGGTTAGGAATCCTGTGCAGGG - Intergenic
935478436 2:103555575-103555597 CAGGTTAGAAAGCTTATTCAAGG - Intergenic
935682524 2:105650349-105650371 GAGGTTTAGAAACTTGTTCAAGG + Intergenic
936351470 2:111716060-111716082 GAGGTTAAGAAACCTGTCCATGG + Intergenic
937579915 2:123472710-123472732 CAGGTCAGGAACCCTGTTCAGGG - Intergenic
938752335 2:134344619-134344641 GAGGTTAGGTAACTTGTTTAAGG + Intronic
938927155 2:136054651-136054673 GAGGTTATGCAGCTTGCTCAAGG + Intergenic
939339538 2:140876578-140876600 CAGGTCAGGAACCCTGTACAGGG - Intronic
940147811 2:150565841-150565863 AAGGTTAAGTAGCCTGTCCAAGG + Intergenic
940324406 2:152410440-152410462 CAGGAGAGGAAGTCTGTTCATGG + Intronic
940987958 2:160067346-160067368 CAGGTCAGGAACCCTGTACAGGG + Intergenic
941030629 2:160507740-160507762 GAGGTTAGGTAACTTGTCCAGGG - Intergenic
941199877 2:162495291-162495313 CAGGTTAGGAACCCTGTACAGGG - Intronic
941321072 2:164055368-164055390 GAGGTATGGAAGCATGATCAGGG - Intergenic
942022507 2:171880932-171880954 AAGGTTAAGTAGCTTGTTCAAGG - Intronic
942120934 2:172776225-172776247 GAGGTTAAGCAACTTGTTCAGGG + Intronic
942171375 2:173292705-173292727 CAGGTTAGGAACCCTGTACAGGG + Intergenic
942629700 2:177942195-177942217 GAGGTTAAGAAGTTTGTCCAAGG - Intronic
942933461 2:181525269-181525291 GAGGTTAAGCTGACTGTTCATGG + Exonic
943092251 2:183389550-183389572 GAGGTTAGGAAGATTGTACTGGG + Intergenic
944530965 2:200667630-200667652 GAATTTAGCATGCCTGTTCATGG + Intronic
945642425 2:212445599-212445621 GAGGTAAGGAAGCATATGCATGG + Intronic
945846355 2:214949788-214949810 TTGGTCAGGAAGCCTGTTCAGGG - Intronic
946168048 2:217877403-217877425 GAGGTTAGCAATCTTGTCCAGGG - Intronic
946701129 2:222415285-222415307 CAGGTCAGGAACCCTGTACAGGG - Intergenic
947287839 2:228537381-228537403 GAGGTCAGGAGCCCTGTACAGGG - Intergenic
948330012 2:237157206-237157228 AACGCTAGGAAGCCTGTTCGAGG - Intergenic
948773966 2:240270466-240270488 GAGGTTGGAAACCCTGTGCAGGG + Intergenic
949029099 2:241780862-241780884 CAGGTCAGGAACCCTGTTCGGGG + Intronic
949030126 2:241791488-241791510 CAGGTCAGGAACCCTGTACAGGG - Intronic
949086336 2:242158956-242158978 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1169243743 20:4008209-4008231 GAGGTTAGGAAACCTGCTGGAGG + Intronic
1169327701 20:4688336-4688358 GAAATTAGGTAGCCTGTCCAAGG - Intronic
1169508257 20:6236464-6236486 TAGCTTAGGCAGCCAGTTCAAGG + Intergenic
1169596843 20:7210075-7210097 GAAGTCAGGAGGCCTGTTAAGGG + Intergenic
1170923450 20:20701175-20701197 CAGGTTAAGAACCTTGTTCAAGG - Intronic
1171992552 20:31708040-31708062 GAGGTTAGGAAGACTCTTCTGGG - Intronic
1172007332 20:31826510-31826532 AAGGCTAGCAGGCCTGTTCAAGG + Intronic
1172980314 20:38936705-38936727 GAGGTTAGGTAGCTTGTTCAAGG - Intronic
1173617931 20:44414919-44414941 GAGGTTAAGTAACCTGCTCAAGG + Intronic
1173957307 20:47043611-47043633 GAGGTTAAGAAACTTGTCCAAGG - Intronic
1173966418 20:47115966-47115988 GAGGGTAGGAAGAGTGTTCTGGG - Intronic
1173969469 20:47140667-47140689 AAGGTTAGGCAACTTGTTCAAGG - Intronic
1174344014 20:49916127-49916149 GAGGTTAGGTAACTTGTCCAAGG - Intergenic
1174345259 20:49924366-49924388 GAGGTTAGATAGCTTGTCCAAGG - Intergenic
1175316626 20:58053311-58053333 GAGGTTAAGAGGCTTGTTTAAGG + Intergenic
1176428617 21:6563244-6563266 GAGCTCAGGAAGCATGTTCCAGG - Intergenic
1177033286 21:16010442-16010464 GAGGTTGGGAAGTCTTTACATGG - Intergenic
1178619741 21:34163169-34163191 CAGGTCAGGAACCCTGTACAGGG + Intergenic
1178810608 21:35877951-35877973 GAGGTTAGGTAGCTTGCTCCAGG + Intronic
1179162335 21:38908877-38908899 GAGGTTAGGAAACTTGTCCAAGG + Intergenic
1179704107 21:43171560-43171582 GAGCTCAGGAAGCATGTTCCAGG - Intronic
1180074403 21:45455422-45455444 GAGGCTGGGAAGCCTGCACAGGG + Intronic
1180874221 22:19167355-19167377 GAGGTCAGGAACCCAGATCAGGG + Intergenic
1182770474 22:32792197-32792219 GAGGTTAAGGAACTTGTTCAAGG + Intronic
1183105206 22:35610515-35610537 GAGGTTAAGCAGCTTGTCCACGG - Intronic
1183347818 22:37317641-37317663 GAGCTTAGGAAACCTGCTTAAGG - Intergenic
1184414170 22:44342525-44342547 GAGGTTAAGTACCCTGTCCAGGG + Intergenic
1184917800 22:47584507-47584529 CAGGTTAGGAACCCTGTACAGGG - Intergenic
949812228 3:8017974-8017996 CAGGTCAGGAACCCTGTACAAGG + Intergenic
950165526 3:10794499-10794521 GAGGTTAAGAAACTTGTCCAGGG - Intergenic
950202740 3:11056579-11056601 GAGGAAAGGCAGCCTGTTCAGGG - Intergenic
950599993 3:14025642-14025664 CAGGTCAGGAACCCTGTACAGGG + Intronic
950701975 3:14757207-14757229 GAGGTTAGGGGACCTGTTCAAGG + Intronic
951251654 3:20400972-20400994 GAGGTTAAGAACCCTGCCCAAGG - Intergenic
951297982 3:20962728-20962750 CAGGTCAGGAACCCTGTACAGGG - Intergenic
951521260 3:23612507-23612529 GAGGAAAGGCAGCCCGTTCAGGG - Intergenic
951696395 3:25449660-25449682 GTGGTTAGGTAACTTGTTCAAGG - Intronic
951802928 3:26616745-26616767 GATGTTATGAAGTCTCTTCATGG + Intergenic
951808223 3:26670699-26670721 GAGGTTAAGGAACTTGTTCAAGG - Intronic
951809482 3:26683593-26683615 GAGGTTAGGAAGGCTGTGGCTGG + Intronic
952456147 3:33473882-33473904 GAGGTTAGGAAGCCCAACCAAGG + Intergenic
952924501 3:38311172-38311194 GAGGCTGGGAATCCAGTTCATGG - Intronic
953341815 3:42140770-42140792 AAGGTTAGGAAGCCTCTTCCGGG + Intronic
953647731 3:44770501-44770523 CAGATTAGGAACCCTGTACAGGG + Intronic
953735875 3:45493531-45493553 GAGGTTAAGAACCTTGTCCAAGG - Intronic
953820623 3:46204769-46204791 GTGGTTAGGAAACATGTTCAAGG + Intronic
954128612 3:48548070-48548092 GAGGTTGGGAAGCTAGTCCAAGG - Intronic
954597955 3:51843035-51843057 CAGGTCAGGAACCCTGTACAGGG + Intergenic
955007096 3:54979211-54979233 CAGGTCAGGAACCCTGTACAGGG + Intronic
955476671 3:59343381-59343403 CTGGTGGGGAAGCCTGTTCATGG + Intergenic
955613129 3:60778888-60778910 CAGGTCAGGAACCCTGTACAGGG - Intronic
955866918 3:63394218-63394240 GAGGTTAAGAGACTTGTTCAAGG - Intronic
956892105 3:73623494-73623516 GAGGTTAAGCAGCTTGCTCAAGG + Intronic
957147261 3:76440471-76440493 GAGTCTAGGAAGCATGGTCAGGG + Intronic
957321833 3:78641231-78641253 GAGGTTAAGAAGTTTGTGCATGG + Intronic
957467706 3:80616240-80616262 GGGGTTAGGGAGCCTGTTGGGGG + Intergenic
957819760 3:85356428-85356450 GAGGTTGGAAAGCTAGTTCAGGG + Intronic
958536450 3:95410694-95410716 CAGGTCAGGAACCCTGTACAGGG - Intergenic
958968257 3:100582721-100582743 CAGGTCAGGAACCCTGTACAGGG + Intergenic
959585153 3:108018899-108018921 AAGGAAAGGGAGCCTGTTCAAGG - Intergenic
959928311 3:111950452-111950474 GAGGTTAAGTAGCTTGTCCAAGG + Intronic
960584371 3:119307190-119307212 GAGGTTTGGTAGCTTGTCCATGG - Intronic
960709152 3:120510273-120510295 CAGGTTGGGAACCCTGTACAGGG - Intergenic
961078627 3:124005048-124005070 GAGGTTAGGAGTCCTGGCCAGGG + Intergenic
961222022 3:125208607-125208629 GAGGTTACGAAACTTGTTCAAGG + Intronic
961326857 3:126113963-126113985 GAGGTTAGGTAACTTGCTCAAGG + Intronic
961918776 3:130404438-130404460 GAAGTTAGGTATCTTGTTCAAGG - Intronic
961930662 3:130529578-130529600 GAGGTGAGGCAGCATGTCCAAGG - Intergenic
962627884 3:137245146-137245168 GAGGTTAAGCATCCTGTTCAAGG - Intergenic
962826373 3:139103669-139103691 GAGGTTAAGTATCCTGCTCAAGG + Intronic
963251556 3:143108816-143108838 CAGGTTAGGAACCCTGTATAGGG - Intergenic
963896651 3:150693393-150693415 CAGGTCAGGAACCCTGTACAGGG - Intronic
963970070 3:151420198-151420220 GAGGTAAGGAAGAGTATTCATGG - Intronic
964332331 3:155617822-155617844 CAGGTTAGGACTCCTGTACAGGG - Intronic
964856148 3:161147987-161148009 CAGGTCAGGAACCCTGTACAGGG - Intronic
964865482 3:161255024-161255046 GAGGCTAGGAAGTCAGATCAGGG + Intergenic
965585389 3:170313372-170313394 GAAGTTAGGTAGCTTATTCATGG + Intergenic
966413350 3:179665475-179665497 GAGGTTAGGTAATTTGTTCAAGG + Intronic
966465879 3:180230946-180230968 CAGGTTAGAAAACCTGTACAGGG - Intergenic
966523488 3:180897659-180897681 CAGGTCAGGAATCCTGTACAGGG - Intronic
966547642 3:181169028-181169050 GAGGTTAGGAAAGTTGTCCAAGG + Intergenic
966759995 3:183409399-183409421 CAGGTTAGGAAGCTTGCCCAAGG - Intronic
967355615 3:188567242-188567264 GAGGTTAAGGAACTTGTTCAAGG - Intronic
967529083 3:190529021-190529043 CTGGTTAGGAAGTCTGTTGAGGG + Intronic
967531293 3:190551160-190551182 CAGGTCAGGAACCCTGTACAAGG + Intronic
968301060 3:197615332-197615354 CAGATCAGGAACCCTGTTCAGGG + Intergenic
968859718 4:3157490-3157512 GAGGGAAGGAAGCCTGTACACGG - Intronic
968945285 4:3660344-3660366 GAGGACAGGAATCCTGGTCACGG + Intergenic
969090003 4:4686568-4686590 GAGGTTAAGCAACTTGTTCAAGG + Intergenic
969116154 4:4871899-4871921 GAGGTGTGGAAGCCTGTGAAGGG + Intergenic
969279115 4:6157654-6157676 GGGGTTAGGTAGCATGTCCAGGG - Intronic
969294081 4:6259121-6259143 AAGGTTAAGACGCTTGTTCAAGG - Intergenic
969303404 4:6310583-6310605 GAGGTTAGGGAACCTGCCCAGGG - Intergenic
969727732 4:8933422-8933444 CAGGTCAGGAACCCTGTACACGG - Intergenic
970225229 4:13850564-13850586 GAGGTTAGGTAACTGGTTCAAGG + Intergenic
970491133 4:16574863-16574885 GAGCTTAGGAAACTTGTTCAAGG + Intronic
971110000 4:23574134-23574156 CAGGTTAGGAATCCTGTACAGGG + Intergenic
971418857 4:26457339-26457361 GAGGTTAGGTAACCTGTCCAAGG - Intergenic
971666299 4:29490198-29490220 GAGGTTAAGTAGCTTATTCAAGG - Intergenic
971856536 4:32051985-32052007 GAAGCTAGGTAGCCTGTTTATGG - Intergenic
972216141 4:36899088-36899110 CAGGTTAGGAACCCTGTGCGGGG - Intergenic
972366553 4:38380996-38381018 GAGGTTAAGTAACTTGTTCAAGG + Intergenic
972428522 4:38958251-38958273 GAGGTTAAGAAACTTGTTCAAGG - Intergenic
972736671 4:41848742-41848764 GAGGATAGGAGGCTTGGTCAAGG + Intergenic
972995677 4:44876664-44876686 GAGGTTAAGTAGCTTGCTCAAGG + Intergenic
973245433 4:48005676-48005698 CAGGTCAGGAACCCTGTACAGGG + Intronic
973264344 4:48196364-48196386 GAGGTTAAGTAACTTGTTCAAGG - Intronic
973533112 4:51852810-51852832 GAAGTTTGGAAGCATGTACAGGG + Intronic
974665519 4:64956324-64956346 CAGGTCAGGAAGCCTGTACAGGG - Intergenic
974922875 4:68264088-68264110 TAGGTCAGGAACCCTGTACAGGG - Intergenic
975382795 4:73721746-73721768 GAGGATATGCAGCTTGTTCAAGG - Intergenic
975411995 4:74064071-74064093 CAGGTCAGGAATCCTGTACAGGG - Intergenic
975439747 4:74397908-74397930 GAGGTTAGGTAACATGCTCAAGG - Intergenic
975724519 4:77278971-77278993 GAGGTTACAAAGCATGTTGAGGG + Intronic
976375315 4:84339210-84339232 GAAGTTGGGAAACCTGTACAAGG - Intergenic
977094626 4:92724666-92724688 GAGGTTAAGTAACTTGTTCAAGG - Intronic
977527483 4:98162844-98162866 CAGGTCAGGAACCCTGTACAGGG - Intergenic
978019679 4:103792198-103792220 CAGGTTAGGAACCCTGTGCAGGG - Intergenic
978048681 4:104167625-104167647 GAGGTTAGGAAGTGGGGTCATGG - Intergenic
978950254 4:114549549-114549571 CAGGTCAGGAACCCTGTACAGGG + Intergenic
979238058 4:118423935-118423957 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
979818227 4:125137486-125137508 GAGGTTAGAAACACTGTTCATGG - Intergenic
980295502 4:130909807-130909829 GAGGGTGGGAAGCATGGTCAGGG + Intergenic
980642789 4:135601498-135601520 CAGGTTAGGAACCCTGTGCAGGG - Intergenic
981255704 4:142658791-142658813 CAGGTCAGGAACCCTGTACAGGG - Intronic
981324458 4:143429600-143429622 CAGGTTAGGAACCCTGTACGGGG + Intronic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
982606667 4:157524513-157524535 CAGGTTAGGAAACCTGTACAGGG + Intergenic
982864418 4:160492319-160492341 CAGGTCAGGAACCCTGTACAGGG - Intergenic
983766950 4:171495937-171495959 GAAGATAGGAATCTTGTTCATGG + Intergenic
983803153 4:171961282-171961304 CAGGTCAGGAACCCTGTACAGGG - Intronic
983915163 4:173283678-173283700 CAGGTTAGGAACCCTGTACAGGG + Intronic
983941803 4:173541167-173541189 GAGGGTAGGCAGTCTGTCCAGGG - Intergenic
984367970 4:178822528-178822550 CAGGTTAGGAACTCTGTGCAGGG + Intergenic
984687651 4:182689614-182689636 GAAGATAGGAAGCCTGTGCATGG - Intronic
987135524 5:14896390-14896412 GAGGTTAGGTAACTTGCTCAAGG - Intergenic
987890247 5:23867109-23867131 CAGGTCAGGAACCCTGTACAGGG - Intergenic
988168977 5:27631090-27631112 GAGGTAAGGAAGAGTATTCATGG - Intergenic
988219847 5:28330075-28330097 CAGGTATGGAAGCCTTTTCATGG + Intergenic
988899849 5:35719945-35719967 CAGGTCAGGAACCCTGTACAAGG + Intronic
989128348 5:38078935-38078957 GAGGTTAAGTAACTTGTTCATGG + Intergenic
989281934 5:39654665-39654687 CAGGTTAGGAACCCTGTGCAGGG - Intergenic
989560345 5:42843026-42843048 GAGCATAGGAAGCCCGTGCATGG - Intronic
989742216 5:44786594-44786616 CAGGTCAGGAATCCTGTGCAGGG + Intergenic
991423659 5:66467381-66467403 CAGGTCAGGAATCCTGTACAGGG + Intergenic
991599574 5:68339180-68339202 GAGGTTAAGTAACCTGCTCAGGG + Intergenic
992365962 5:76089799-76089821 GAGGTTAAGAAACTTGTTCATGG - Intronic
992426308 5:76661592-76661614 GAGGTTAAGAAACATGCTCAAGG - Intronic
994360164 5:98840976-98840998 TAGATTAGGAACCCTGTACAGGG + Intergenic
995320572 5:110829357-110829379 CAGGTTAGGAACCCTGTACAGGG - Intergenic
995830148 5:116346023-116346045 CAGGTCAGGAACCCTGTACATGG + Intronic
996045414 5:118867540-118867562 GAGGTTAGGTAACTTGCTCAAGG - Intronic
996574363 5:124965631-124965653 CAGGTCAGGAACCCTGTACAGGG - Intergenic
996677516 5:126193673-126193695 GACGTTGGGAAGCCTATTCTGGG + Intergenic
997404801 5:133636936-133636958 GAGGTTAGGCAACTTATTCATGG + Intergenic
998393958 5:141806396-141806418 GAGGGAAGGAAGAGTGTTCACGG + Intergenic
998706932 5:144772701-144772723 CAGGCTAGGTAACCTGTTCATGG + Intergenic
999008053 5:148004454-148004476 CAGGTCAGGAACCCTGTACAGGG - Intergenic
999828223 5:155294427-155294449 GAGGTTAAGTAACTTGTTCAAGG + Intergenic
1000330279 5:160200129-160200151 GAGGTTAGGAAGGCTGTCTAAGG - Intronic
1000440567 5:161258458-161258480 GAGGTTCAGAAACTTGTTCAAGG - Intergenic
1001966321 5:175912208-175912230 GAGGTTAGGCAGCTTGCCCAAGG - Intergenic
1002030500 5:176425305-176425327 CAGGTCAGGAACCCTGTACAGGG + Intergenic
1002250626 5:177926995-177927017 GAGGTTAGGCAGCTTGCCCAAGG + Intergenic
1002719347 5:181248226-181248248 CAGCTTAGGTTGCCTGTTCAGGG + Intergenic
1002738486 5:181415911-181415933 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1003081691 6:3026484-3026506 GAGGTGGGGGAGCTTGTTCAGGG - Intergenic
1003083324 6:3040084-3040106 CAGGTTAGGAACCCTGCACAGGG - Intergenic
1003374675 6:5564862-5564884 CAGGTTAGGAATCCTGTGCGGGG + Intronic
1003985258 6:11428586-11428608 TAGGACAGGAAGCTTGTTCATGG - Intergenic
1004646120 6:17562452-17562474 CAGGTCAGGAACCCTGTACAGGG + Intergenic
1005371162 6:25135186-25135208 CAGGTCAGGAACCCTGTACAGGG - Intergenic
1006246861 6:32745021-32745043 GGTGTTAGGAAGATTGTTCAGGG + Intronic
1006513262 6:34532909-34532931 GAGGTTAGGAAACCAGGCCAGGG - Exonic
1006743826 6:36327403-36327425 GAGGTTAAGAAACTTATTCAAGG - Intronic
1007112675 6:39322112-39322134 GAGGTTAAGTGACCTGTTCAAGG + Intronic
1007159521 6:39777766-39777788 GAGGTGAGGAGGCCTATTTAAGG - Intergenic
1007915651 6:45559273-45559295 GAGGTTAAGTGGCTTGTTCAAGG - Intronic
1010160266 6:72845988-72846010 GAGGTTAGGAAGCCTGTTCAGGG + Intronic
1010325858 6:74561146-74561168 GAGGTAAGGAAGACTATGCATGG + Intergenic
1010718651 6:79258627-79258649 CAGGTCAGGAACCCTGTACAGGG + Intergenic
1010872618 6:81060832-81060854 CAGGTCAGGAACCCTGTTTAGGG + Intergenic
1011590960 6:88970519-88970541 CAGGTCAGGAACCCTGTACAGGG - Intergenic
1011795243 6:90945945-90945967 AAGGTTAAGTAGCTTGTTCAAGG + Intergenic
1012047024 6:94289405-94289427 GAGGGTAGGAAGCCTTCCCAGGG + Intergenic
1012114098 6:95271708-95271730 GAGGTGAGGAAGCCTCTGCTAGG + Intergenic
1012301787 6:97598419-97598441 GAGGTTAAGAAACTTGTCCAAGG - Intergenic
1012332938 6:98016694-98016716 GAGGTTATGTAACCTGATCAAGG - Intergenic
1012594810 6:101027130-101027152 CAGGTTAGGAACCCTGTACAAGG - Intergenic
1012936555 6:105373762-105373784 GAGGTTAGGAAGCTTGTCTAAGG - Intronic
1013580347 6:111527887-111527909 GAGGCTAGGTAGTCTGTCCAGGG + Intergenic
1013601404 6:111708515-111708537 GAGGTTAGGAGGTCTGATGAGGG + Intronic
1013609500 6:111781036-111781058 AAGGTTAGGAAAACTGTCCAGGG - Intronic
1013876071 6:114830367-114830389 GAGGTTAAGCAACCTGTCCAAGG + Intergenic
1014455777 6:121633133-121633155 CAGGTCAGGAACCCTGTACAGGG + Intergenic
1015092844 6:129379593-129379615 GAGGGTAGGAAGACTCTTCAGGG - Intronic
1015153970 6:130069741-130069763 GAATTTAGGAAGACCGTTCAAGG - Intronic
1015678946 6:135781994-135782016 GAGGTTAGGAATCCACTGCATGG - Intergenic
1015858923 6:137655529-137655551 CAGGTCAGGAACCCTGTACAGGG - Intergenic
1016014831 6:139173091-139173113 CATGTTAGGAAGTCCGTTCAAGG - Intronic
1016309896 6:142723152-142723174 GAGGTTGTGCAGCCTGTGCAGGG - Intergenic
1017215625 6:151902629-151902651 GAGGTTACGTATCTTGTTCAAGG - Intronic
1017559450 6:155611074-155611096 CAGGTTAGGGACCCTGTACAGGG + Intergenic
1017663349 6:156695376-156695398 GAGTTTAGGCAACCTGTTCAAGG - Intergenic
1017817461 6:158026341-158026363 GAGGTTAAGCAGCCTGCCCAAGG - Intronic
1018078352 6:160236715-160236737 CAGGTCAGGAACCCTGTACAGGG - Intronic
1018083507 6:160278899-160278921 GAGGGCAGGATGCCTGTGCAGGG - Intergenic
1018179823 6:161213041-161213063 CAGGTCAGGAACCCTGTGCAGGG - Intronic
1018441349 6:163816361-163816383 GAGGTTAAGAAACATGTCCAAGG - Intergenic
1018489361 6:164275826-164275848 CAGGCAAGAAAGCCTGTTCAGGG - Intergenic
1019243589 6:170691463-170691485 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1019512049 7:1422592-1422614 GAGGGAAGGGAGCCTGTTCCCGG - Intergenic
1020555623 7:9665746-9665768 CAGGTCAGGAACCCTGTACAGGG + Intergenic
1020638113 7:10721443-10721465 GAGGTTAAGTAGCATATTCAAGG - Intergenic
1021000693 7:15327143-15327165 CAGGTTATGATGCCTGTTCTGGG - Intronic
1021441173 7:20678430-20678452 AAAGTTAAGAAGCTTGTTCAGGG - Intronic
1022012277 7:26318930-26318952 GAGGTTAAGTAACTTGTTCAAGG + Intronic
1023033796 7:36112855-36112877 GAGGTTAGGAAGCCATTACTTGG + Intergenic
1024398174 7:48893024-48893046 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1024491342 7:49989255-49989277 CAGGTTAGGAACCCCGTACAGGG - Intronic
1024778408 7:52816383-52816405 GAGGTTGGCAAGCCTGTACCAGG - Intergenic
1025634649 7:63311901-63311923 CAGGTTAGGAACCCTGTATAGGG - Intergenic
1025648047 7:63436269-63436291 CAGGTTAGGAACCCTGTATAGGG + Intergenic
1025741352 7:64199141-64199163 CAGGTTAGGAACCCTGTACAGGG + Intronic
1027406815 7:77871279-77871301 GAGGTAAGGAAGAGTATTCATGG - Intronic
1027414462 7:77960177-77960199 GAGGTTAAGAAGCTTGTCCAAGG + Intergenic
1027420111 7:78010596-78010618 CAGGTTAAGAACCCTGTACAGGG - Intergenic
1027422123 7:78027026-78027048 GAGGTTAAGGAACTTGTTCAAGG + Intronic
1027759470 7:82259821-82259843 GAGGTTAAGTAACTTGTTCAAGG - Intronic
1028146391 7:87324316-87324338 CAGGTTAGGAACCCTGTTCGGGG + Intergenic
1028648829 7:93127881-93127903 CAGGTCAGGAACCCTGTGCAGGG - Intergenic
1030245604 7:107382149-107382171 CAGGTCAGGAACCCTGTACAGGG - Intronic
1031227296 7:119055801-119055823 CAGGTCAGGAACCCTGTACAGGG + Intergenic
1031682249 7:124689010-124689032 GAGGTAAGGAAGAGTATTCATGG + Intergenic
1032251277 7:130259996-130260018 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1032500518 7:132396421-132396443 GAGGTTAAGTAGCATGTCCAAGG + Intronic
1032639344 7:133748645-133748667 GAGCACAGGAAGCCTGTACATGG - Intronic
1033286148 7:140042305-140042327 AAGGTGAAGAAACCTGTTCAAGG + Intronic
1034226488 7:149488703-149488725 GACGTTAGGAAGCAAGTTCTAGG + Intronic
1034231650 7:149534161-149534183 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1034932605 7:155174312-155174334 GAGGTTAGGTAACTTGCTCAAGG - Intergenic
1035380083 7:158432314-158432336 GAGGTTTGGATGCTTGTTCAGGG - Intronic
1035504533 8:116697-116719 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
1037105665 8:15104213-15104235 GAGGGTAGGAATCCTGTGCAAGG - Intronic
1037583829 8:20262915-20262937 GAGGTTACGTAGCATGTCCACGG - Intronic
1038037423 8:23698338-23698360 GAGGTTAGGAGGCTTACTCAAGG + Intergenic
1038061674 8:23921014-23921036 GAGGTTAAGAAGCATGTCTAAGG - Intergenic
1038400465 8:27280487-27280509 GAGGTCAGGGGGCTTGTTCAAGG - Intergenic
1038490528 8:27967410-27967432 GAGATCAGTAAGCCTCTTCATGG - Intronic
1038576375 8:28707301-28707323 AAGGATAGGAAACTTGTTCAAGG - Intronic
1039184083 8:34897533-34897555 CAGGTCAGGAACCCTGTGCAGGG - Intergenic
1039895938 8:41716489-41716511 GTGGTTAGGAAGCCTGCTGTTGG + Intronic
1040064803 8:43137129-43137151 CAGGTCAGGAACCCTGTACAGGG - Intergenic
1040526663 8:48231710-48231732 CAGGTTAGAAACCCTGTGCAGGG - Intergenic
1041010323 8:53535922-53535944 GATGTTAGGAAACTTGTTCAAGG - Intergenic
1041434601 8:57824597-57824619 CTGGTTAGGAAGTCTGTACATGG + Intergenic
1041911999 8:63098878-63098900 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1042404219 8:68385250-68385272 GAGGTTAAGAAACTTGTCCAAGG + Intronic
1043676964 8:82968839-82968861 TAGGTCAGGAACCCTGTACAGGG + Intergenic
1043939529 8:86181087-86181109 GAGGTTAAGTAACTTGTTCAAGG - Intergenic
1044198551 8:89407738-89407760 TAAGTCAGGAAGCCTGTACAGGG - Intergenic
1045428488 8:102090976-102090998 CAGGTCAGGAACCCTGTACACGG - Intronic
1045603212 8:103742968-103742990 GACCTTAAAAAGCCTGTTCATGG - Intronic
1047141936 8:122151336-122151358 GAGGGTAAGAAGCCTGTGAATGG - Intergenic
1047208053 8:122819250-122819272 GTGGTCAGGCAGCCTGCTCAAGG - Intronic
1047224273 8:122943404-122943426 GAGGTTAAGGAGCTTGGTCAAGG - Intronic
1047526267 8:125637006-125637028 GAGGTTAAGAAACTTGTTCAAGG - Intergenic
1047530029 8:125665989-125666011 GAGGTTAAGTATGCTGTTCAAGG + Intergenic
1047541079 8:125767408-125767430 GAAGTTAGGAGACATGTTCATGG + Intergenic
1047581406 8:126219766-126219788 CAGGTTAGAAACCCTGTACAGGG + Intergenic
1048175908 8:132152666-132152688 CAGGTCAGGAACCCTGTACAGGG - Intronic
1048223787 8:132566136-132566158 GAGGCAAGGGAGCCTGTTGATGG - Intergenic
1048264819 8:132976485-132976507 GAGGTGTGGAAGCCTGTTGCTGG + Intronic
1048686822 8:136913261-136913283 CAGGTTAGGAACCCTGTACAAGG + Intergenic
1048842561 8:138578484-138578506 CTGGTTAGGAAGCCTCTTAAGGG - Intergenic
1049448515 8:142643634-142643656 CAGGTCAGGAACCCTGTACAGGG + Intergenic
1049931127 9:457931-457953 GAGGTTAAGTAGCTTGTTTAAGG + Intronic
1050191299 9:3029388-3029410 GAGGGAAGGAAGCCTGTTTCTGG + Intergenic
1051734639 9:20186065-20186087 GAGCTAAGGAAGCCTCATCATGG - Intergenic
1052007651 9:23368567-23368589 GAGCTTAGCAAGCATGTTTAAGG + Intergenic
1052616919 9:30853589-30853611 CAGGTCAGGAACCCTGTGCAGGG - Intergenic
1053075740 9:35132875-35132897 CAGGTTAGGAACCCTGTATAGGG - Intergenic
1053446939 9:38159803-38159825 GAGGTGAGGGAGCTTGATCAAGG + Intergenic
1054830119 9:69615567-69615589 GAGGCTAGGAAGCCAGATCAAGG - Intronic
1054898413 9:70339967-70339989 GTGGTTAGGAAACCTGCCCATGG - Intronic
1054963341 9:70994171-70994193 GAGATTAGGTATCTTGTTCAAGG - Intronic
1055361199 9:75492238-75492260 GAGGTTAAGAATCTTGCTCAAGG + Intergenic
1055663903 9:78534276-78534298 AAGGTTACTAATCCTGTTCATGG - Intergenic
1055963391 9:81842235-81842257 GAGGTTAAGAAACTTGCTCAAGG + Intergenic
1057097680 9:92326651-92326673 GAAGTTAGGTAGCTTGTCCAAGG + Intronic
1057467192 9:95325022-95325044 CAGGTCAGGAACCCTGTACAGGG + Intergenic
1057774721 9:97998013-97998035 GAGGTTATGAAGCTTCTTTATGG + Intronic
1057954124 9:99393923-99393945 GAGGTTAGGAGGCTTATCCAAGG + Intergenic
1058067116 9:100561988-100562010 GAGGTTATGTAACTTGTTCAAGG + Intronic
1059469563 9:114494493-114494515 GACGTTAGGAAGCTGGTTCAAGG + Intronic
1059536393 9:115084900-115084922 GAGGTGAGCAAGCTTGGTCAAGG - Intronic
1062064041 9:134516663-134516685 GGGGTTAGGCAACCTGTCCAAGG - Intergenic
1203341867 Un_KI270423v1:257-279 GAGGTGAGCAATCCTGTTGATGG + Intergenic
1203603778 Un_KI270748v1:40686-40708 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1185500031 X:589644-589666 GGGGTTAAGAAGCCGGTTCCAGG - Intergenic
1186308816 X:8294650-8294672 GTGGTTGGAAAGCCTATTCATGG - Intergenic
1186353940 X:8770091-8770113 CAGGTCAGGAACCCTGTACAGGG + Intergenic
1187095089 X:16139775-16139797 GAGGTTAAGTAACTTGTTCACGG - Intronic
1187410275 X:19045131-19045153 GAGGTTTAGAAACTTGTTCAAGG + Intronic
1187817251 X:23246195-23246217 CAGGTCAGGAACCCTGTACAGGG - Intergenic
1188000753 X:24978658-24978680 GAGGTTTAAAAGCCTGCTCAAGG + Intronic
1188862585 X:35274214-35274236 CAGGTCAGGAACCCTGTCCAGGG + Intergenic
1190490862 X:50981795-50981817 CAGGTCAGGAACCCTGTACAGGG - Intergenic
1190723036 X:53166868-53166890 CAGGTTAGGAACCCTGTGCAGGG - Intergenic
1190956818 X:55203227-55203249 CAGGTCAGGAACCCTGTACAGGG + Intronic
1191031899 X:55982648-55982670 GAGGTTAGGCAACTTATTCAAGG - Intergenic
1191069670 X:56386597-56386619 CAGGTTAGGAACCCTGTACAGGG + Intergenic
1191189743 X:57654226-57654248 CAGATTAGGAACCCTGTACAAGG - Intergenic
1191218919 X:57964783-57964805 CAGGTCAGGAACCCTGTACAGGG + Intergenic
1191644824 X:63468639-63468661 CAGGTCAGGAAGCCTGTACAGGG + Intergenic
1191862119 X:65674270-65674292 GGGGTTAGGCAGCTTGTTCGAGG + Intronic
1192227375 X:69238552-69238574 GAGGTTAGGAACCCTGCGCCAGG - Intergenic
1192245527 X:69368781-69368803 GAGGTTTTGTAACCTGTTCAAGG + Intergenic
1192681284 X:73256182-73256204 CAGGTTAGAAACCCTGTACAGGG + Intergenic
1193265296 X:79462267-79462289 CAGGTAAGGAACCCTGTACAGGG - Intergenic
1195029147 X:100909510-100909532 AAGGTTAAGAGGCCTGTCCAAGG - Intergenic
1195219505 X:102732941-102732963 CAGGTCAGGAACCCTGTACAGGG + Intronic
1195797883 X:108671955-108671977 GAGGTTAAGAAACTTGCTCAGGG + Intronic
1196130277 X:112147924-112147946 GGGGTTAGGAAGAGAGTTCAGGG - Intergenic
1196520489 X:116665389-116665411 CAGGTCAGGAACCCTGTACAGGG + Intergenic
1196768479 X:119270967-119270989 GAGGTTAGGTAGCATGCCCAAGG - Intergenic
1197062150 X:122194588-122194610 CAGGTCAGGAACCCTGTACAGGG - Intergenic
1197365929 X:125564424-125564446 CAGGTCAGGAACCCTGTACAGGG + Intergenic
1197860638 X:130966338-130966360 GAGTTTAGGAAGTCTGATCTGGG + Intergenic
1198847112 X:140924265-140924287 CAGGTCAGGAACCCTGTACAGGG + Intergenic
1199520147 X:148726145-148726167 GAGCATAGGAAGCCTGCACATGG - Intronic
1199563406 X:149188079-149188101 GAGGTTATGAATCATGTTCAAGG - Intergenic
1201901857 Y:19051716-19051738 GAGGTTAAGACACCTGCTCAGGG + Intergenic
1201923846 Y:19263487-19263509 CAGGTTAGGATCCCTGTACAAGG + Intergenic