ID: 1010162862

View in Genome Browser
Species Human (GRCh38)
Location 6:72878575-72878597
Sequence GGAATATAGAGACCAAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 332}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010162855_1010162862 29 Left 1010162855 6:72878523-72878545 CCATGACAGGGAATCAATTACTC 0: 1
1: 0
2: 1
3: 8
4: 108
Right 1010162862 6:72878575-72878597 GGAATATAGAGACCAAAATCTGG 0: 1
1: 0
2: 1
3: 47
4: 332
1010162861_1010162862 -4 Left 1010162861 6:72878556-72878578 CCTGGCTGGGTACTTTTATGGAA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1010162862 6:72878575-72878597 GGAATATAGAGACCAAAATCTGG 0: 1
1: 0
2: 1
3: 47
4: 332
1010162854_1010162862 30 Left 1010162854 6:72878522-72878544 CCCATGACAGGGAATCAATTACT 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1010162862 6:72878575-72878597 GGAATATAGAGACCAAAATCTGG 0: 1
1: 0
2: 1
3: 47
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010162862 Original CRISPR GGAATATAGAGACCAAAATC TGG Intronic
902836685 1:19051925-19051947 GGTATACAGAGGCCAACATCTGG + Intergenic
903156587 1:21448449-21448471 GGAATACAGAGCCCAGAAACAGG - Intronic
904790293 1:33015289-33015311 GGAATATAGAGCTCAAGAACAGG + Intronic
905367663 1:37463008-37463030 GGAAAAGAGAGAAAAAAATCTGG + Intergenic
906895919 1:49771813-49771835 GAAAAATAGAAACCAAAAGCAGG - Intronic
907361584 1:53920572-53920594 GGTATTTAGAGATCACAATCTGG + Intronic
908373895 1:63513526-63513548 GGTATTTAGACACCAAAATCTGG + Intronic
908563317 1:65328976-65328998 GGAAAATACAGAACATAATCAGG - Intronic
909290363 1:73875234-73875256 AGAATATAGAGACCTATATTTGG + Intergenic
910482425 1:87673174-87673196 GGAATCTAGAGACAAAACACTGG + Intergenic
910528102 1:88204169-88204191 GGAATGTAGAGTCCAAACACTGG - Intergenic
910909721 1:92220207-92220229 GCTATTTAGAAACCAAAATCTGG + Intronic
917161542 1:172062229-172062251 GGAAGAGAGAGATAAAAATCTGG + Intronic
918166279 1:181951120-181951142 AGAATAAAGAGAAAAAAATCAGG - Intergenic
918276736 1:182960027-182960049 GGAAGCTGGAGAGCAAAATCCGG - Intergenic
918454834 1:184699235-184699257 GGAATATAGAGATGAGAAGCAGG + Intronic
920585071 1:207150958-207150980 GAAATAGAGACATCAAAATCTGG - Intergenic
920783456 1:209017261-209017283 GGTGTTTAGAAACCAAAATCTGG + Intergenic
921224397 1:213003522-213003544 GGAATATAGAGGCCCAAGTAGGG + Intronic
922185778 1:223273210-223273232 GGAATATAGTGACCAAGAAGGGG + Intronic
923007322 1:230061057-230061079 GGTATTTAGAAACCAAGATCTGG + Intronic
923782471 1:237037251-237037273 GGGATATAAAGACAAGAATCAGG + Intergenic
924790683 1:247244914-247244936 GGTATTTAGAAATCAAAATCTGG - Intergenic
1062861174 10:811014-811036 AGTATATAGAGAGCAAAAACTGG - Exonic
1063562716 10:7144247-7144269 GGAATGTAGAGACCAACAAGAGG - Intergenic
1063582728 10:7323488-7323510 GGAAAATAAACACCAAATTCAGG + Intronic
1064169014 10:13013205-13013227 GATATTTAGAAACCAAAATCTGG - Intronic
1064813266 10:19226537-19226559 TGAATCTAGAGATCAATATCAGG - Intronic
1065976835 10:30849123-30849145 AGAATTCAGAGACCAAAAGCTGG - Exonic
1066698828 10:38104675-38104697 GGAATTTAAAAACCAAGATCTGG + Intronic
1066993823 10:42543552-42543574 GGAATTTAAAAACCAAGATCTGG - Intergenic
1068896399 10:62208298-62208320 AGTATTTAGAGACCATAATCTGG - Intronic
1070869273 10:79735266-79735288 GGTATTTAGAAACCAAGATCTGG + Intergenic
1071636192 10:87257453-87257475 GGTATTTAGAAACCAAGATCTGG + Intergenic
1071659049 10:87480490-87480512 GGTATTTAGAAACCAAGATCTGG - Intergenic
1072288097 10:93936253-93936275 GAAATTTAGAAACCAAGATCTGG - Intronic
1073523589 10:104157849-104157871 GGTATTTAGAGACCAAGATCTGG - Intronic
1073545809 10:104347884-104347906 GGAATCCACAGACCAAAAACAGG - Intergenic
1074487931 10:113906484-113906506 AGATTATACAGACCAAAATTTGG - Intronic
1074775452 10:116765210-116765232 GGTATTTAGAAACCAAAACCTGG - Intergenic
1074782628 10:116812846-116812868 GGAATGGAGGGACCAAAATGAGG + Intergenic
1074961795 10:118453073-118453095 AGTATTTAGAGACCACAATCTGG - Intergenic
1075270861 10:121049255-121049277 AGAATATAGAGACATAAATGTGG - Intergenic
1077149281 11:1062033-1062055 GGTATTTAGAAACCAAGATCTGG + Intergenic
1078149337 11:8745364-8745386 GGAATCTTGTCACCAAAATCAGG - Intronic
1078189801 11:9084029-9084051 GGTCTATAGAAACCAAGATCTGG - Intronic
1080827596 11:35861197-35861219 GGAAACTGGAGAGCAAAATCTGG - Intergenic
1080851703 11:36076062-36076084 GGTATTTAGAAACCAAGATCTGG + Intronic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1083548600 11:63567882-63567904 GGACAATAGAGACAAAATTCAGG - Intergenic
1085556686 11:77429024-77429046 GGCATTTAGAATCCAAAATCTGG - Intronic
1086512629 11:87575626-87575648 TGACTAAAGAGACAAAAATCTGG - Intergenic
1087750645 11:102003258-102003280 GGTATTTAGAAACCAAGATCTGG - Intergenic
1088127148 11:106441676-106441698 GAAATATAGAAACCAAGATGTGG + Intergenic
1089147811 11:116343126-116343148 GGTATATAGTGACTAAAATCTGG - Intergenic
1089481440 11:118808418-118808440 GGTATTTAGAGACCAAGATTTGG - Intergenic
1090200606 11:124852740-124852762 GGAATATAGACACCCAAAGAGGG + Intergenic
1090633444 11:128670667-128670689 GGAAAATAGAGGCCAAGATGAGG + Intergenic
1090805919 11:130202050-130202072 GGTATTTAGAGACCAAGGTCCGG + Intronic
1096150936 12:49312154-49312176 GTTATTTAGAAACCAAAATCTGG - Intergenic
1097559489 12:61185307-61185329 CCAATAGAGAGAGCAAAATCAGG + Intergenic
1098050320 12:66446113-66446135 GGACTGAAGAGACCAAACTCTGG - Intronic
1098389691 12:69956514-69956536 GGAAAGGAGAGACTAAAATCAGG - Intronic
1098560834 12:71870013-71870035 GAAATATACAGAACAAATTCTGG - Intronic
1098784550 12:74734936-74734958 GGAAGACAGAGAGCAAAATGAGG - Intergenic
1099591377 12:84595354-84595376 GGAAATAATAGACCAAAATCTGG + Intergenic
1099851608 12:88105062-88105084 GGCATTTAGATACCAAAAACTGG - Intronic
1099971933 12:89509475-89509497 GGTATTTAGAAACCAATATCTGG + Intronic
1100323268 12:93517271-93517293 GGTATCTAGAAACCAAGATCTGG + Intergenic
1102208853 12:111109621-111109643 GGTATTTAGAGACCACAGTCTGG + Intronic
1104393531 12:128411661-128411683 GGTATTTAGAAACCAATATCTGG + Intronic
1105537597 13:21283099-21283121 GGTATTTAGAAACCAAATTCTGG + Intergenic
1105759414 13:23499805-23499827 GGTATGTAGAAACCAAGATCTGG - Intergenic
1106565071 13:30877221-30877243 GGAATCTGGAATCCAAAATCAGG + Intergenic
1107866427 13:44707713-44707735 GGTATTTAGAAACCAAGATCTGG + Intergenic
1108250931 13:48567160-48567182 GATATTTAGAAACCAAAATCTGG + Intergenic
1111121261 13:83853731-83853753 AGAATATAGAGAACAATACCTGG + Intergenic
1111625821 13:90785345-90785367 GTAAAATAGAGACCAAAAAAAGG - Intergenic
1112741291 13:102475669-102475691 TGAATTTAGAGACCCAGATCTGG + Intergenic
1114440529 14:22743035-22743057 GGTATTTAGAAACCAAGATCTGG - Intergenic
1115344495 14:32327863-32327885 GGAATTAAGAGACCAAAAGCAGG - Intergenic
1118168854 14:63365143-63365165 GGTATTTAGAAACCAAGATCTGG - Intergenic
1119754845 14:77109064-77109086 GGCATTTAGAAACCAAGATCTGG + Intronic
1120421500 14:84292166-84292188 GGAAGCTAAAGTCCAAAATCGGG + Intergenic
1120456452 14:84736871-84736893 GGCATATGGAGAGCAAAGTCTGG + Intergenic
1120536775 14:85706016-85706038 GGAACATATACAACAAAATCTGG + Intergenic
1120699524 14:87683507-87683529 GGTATTTAGAGACCATAATCTGG - Intergenic
1121391503 14:93579789-93579811 GGTATTTAGAAACCAAGATCTGG + Intronic
1123979972 15:25592679-25592701 GGCATTTAGAGACCACAATCTGG + Intergenic
1124611112 15:31209426-31209448 GCAATTTAGAGACCACAGTCTGG - Intergenic
1126427448 15:48544478-48544500 GGAATAAAGAAAATAAAATCAGG - Intronic
1126613320 15:50551474-50551496 GGTATTTAGAAACCAAGATCTGG + Intergenic
1127322496 15:57860899-57860921 GGTATTTAGAAACCAAGATCTGG + Intergenic
1127590225 15:60415248-60415270 GGGATATAGAAACCAAGATCTGG + Intergenic
1128733710 15:70037940-70037962 GGTATTTGGAGACCATAATCTGG - Intergenic
1129278565 15:74464812-74464834 GGTATATTAAGACCACAATCTGG + Intergenic
1129793387 15:78357637-78357659 GGCATTTAGAAACCACAATCTGG + Intergenic
1130365251 15:83232188-83232210 GGTATATAGAGACCACAATCTGG + Intergenic
1131365605 15:91836942-91836964 GAGAAATAGAGACCCAAATCTGG + Intergenic
1132009274 15:98260785-98260807 GGTATTTAGAGACCATAATCTGG - Intergenic
1132329978 15:101005582-101005604 GGTATTTAGAAACCAAGATCTGG - Intronic
1133650639 16:7809986-7810008 GAAATAGTGAAACCAAAATCTGG + Intergenic
1134374227 16:13655557-13655579 GGTATGTAGAGACCACAGTCTGG - Intergenic
1135545322 16:23362041-23362063 GGTATTTAGAAACCAAGATCTGG + Intronic
1135998818 16:27274053-27274075 GGAATAGAGAGTCCAAAGTCTGG - Intronic
1136066772 16:27764551-27764573 GGTATTTAGAGACCATAATCTGG + Intronic
1138954943 16:61960556-61960578 GGAATATTGAGCCCATAAGCTGG + Intronic
1140181934 16:72728931-72728953 GGAAGCTAGAGAGCAAAATCCGG + Intergenic
1140863983 16:79043834-79043856 GGGATGTAGAGAGCAAACTCTGG + Intronic
1141525588 16:84609267-84609289 GGAGTATAGCGACCAAAAGAAGG - Intronic
1143737002 17:8918200-8918222 GGTATTTAGAAACCAAGATCTGG - Intronic
1146295429 17:31646155-31646177 GGTATGTAGAAGCCAAAATCTGG - Intergenic
1146748251 17:35351599-35351621 TGATATTAGAGACCAAAATCTGG - Exonic
1147771435 17:42870755-42870777 GGTATTTAGAAACCAATATCTGG + Intergenic
1151006608 17:70445017-70445039 GGTGTTTAGGGACCAAAATCTGG - Intergenic
1151050223 17:70969871-70969893 GGGAAATAGAGACGAAAATGTGG - Intergenic
1151485299 17:74395196-74395218 GGAAGATAGAAACACAAATCTGG + Intergenic
1152731471 17:81973636-81973658 GGGATTTAGAGACCAAGTTCTGG - Intergenic
1153510403 18:5845763-5845785 GGGATTTAGAAACCAAGATCTGG + Intergenic
1153771438 18:8419888-8419910 TGATGTTAGAGACCAAAATCTGG + Intergenic
1154075412 18:11195793-11195815 GGCATAGAGAGACCACATTCTGG - Intergenic
1154094360 18:11398099-11398121 TGATTATAGAGGACAAAATCAGG + Intergenic
1156131914 18:33986969-33986991 GAAATATAGAGACAAAAAACAGG + Intronic
1156602277 18:38623352-38623374 GGAATTTAGAAACCCAAATCTGG - Intergenic
1157126129 18:44957863-44957885 GGAATAAAGAGAGTAAAACCTGG + Intronic
1157155734 18:45263917-45263939 GGCATTTAGAAACCAAGATCTGG + Intronic
1157424860 18:47576360-47576382 GAAATATAGAGAAAAACATCAGG + Intergenic
1158427332 18:57352184-57352206 GGAATAGAGAGACAAATAACCGG - Exonic
1159525880 18:69588147-69588169 GTATGATAGAGACCAAAATCAGG + Intronic
1163986826 19:20961403-20961425 GGAAGGTGGAGAGCAAAATCTGG + Intergenic
1164773550 19:30832238-30832260 GGCATTTAGAAACCACAATCTGG + Intergenic
1164777793 19:30867091-30867113 GGTATTTAGAGACCACAATCTGG - Intergenic
1166353515 19:42212998-42213020 GGTATTTAGAGACCAAAACCTGG - Intronic
1167151841 19:47714529-47714551 GGAAGATAGAGAACACAGTCTGG + Intronic
1167574097 19:50309515-50309537 GGAAGAGAGAGAACAAAATAAGG - Intronic
924981761 2:229189-229211 GAAAGATAAAGACCAAAACCTGG + Intronic
925281018 2:2684744-2684766 GGAATATAGAATGAAAAATCAGG + Intergenic
927359265 2:22213272-22213294 GAAATAAAGACATCAAAATCGGG - Intergenic
927659143 2:24977498-24977520 GGTATTTAGAAACCAAGATCTGG + Intergenic
928416315 2:31094945-31094967 GGAATATCAAGATCAAAATCAGG + Intronic
929965692 2:46534534-46534556 GGCAAATAGAACCCAAAATCAGG - Intronic
930261304 2:49149727-49149749 GGAATATGGAGATCTAAACCAGG + Intronic
931223822 2:60312235-60312257 CCACTACAGAGACCAAAATCTGG - Intergenic
931297207 2:60938941-60938963 GGTATTTAGAAACCAAGATCTGG - Intergenic
931573157 2:63691135-63691157 GGATAATAGAGACTAAAAGCTGG - Intronic
931791365 2:65666784-65666806 GGAAGCTGGAGAGCAAAATCCGG + Intergenic
932185187 2:69688919-69688941 GAAATTTAGAGACCAAACTCTGG + Intronic
932537091 2:72610388-72610410 GGTATTTAGAAACCAAGATCTGG - Intronic
932743173 2:74307673-74307695 GGAAGCTGGAGAGCAAAATCCGG - Intronic
933439086 2:82286826-82286848 GGAATATAAAGACCTAAACTGGG - Intergenic
933563662 2:83921799-83921821 GGTATTTAGAAGCCAAAATCTGG - Intergenic
934844502 2:97654013-97654035 GGTATTTAGAAACCAAGATCTGG + Intergenic
934905507 2:98197886-98197908 GGTATTTAGAAACCAAGATCTGG + Intronic
935092882 2:99913608-99913630 GGTATTTAGAAACCAAGATCCGG - Intronic
937840906 2:126523708-126523730 GGAATTTATAGCCAAAAATCAGG + Intergenic
939291885 2:140206574-140206596 GGAAGTTAGAGATCATAATCAGG + Intergenic
940333122 2:152496984-152497006 GGTATATAGAAACCAAAATTTGG + Intronic
940519702 2:154728738-154728760 GGCATATAGAAACTAAAACCAGG - Intronic
940808254 2:158212439-158212461 GGAAAATAGAGAGAAACATCTGG + Intronic
941341935 2:164317064-164317086 AGAACATAGAGATCCAAATCAGG + Intergenic
941833515 2:169990041-169990063 GGTATTTAGAGACAAAAGTCTGG + Intronic
941836738 2:170030326-170030348 GGTATTTAGAGACCACAGTCTGG + Intronic
941913828 2:170794452-170794474 AGAATAAAGAAACCAAAAACAGG - Intronic
942266851 2:174236174-174236196 GAAATATATATACCAAAATCAGG + Intronic
942797074 2:179834234-179834256 GGTATTTAGAAACCAAAATCTGG - Intronic
942971403 2:181962140-181962162 GGAAGCTGGAGAGCAAAATCCGG - Intronic
943241890 2:185395817-185395839 GGAATAAATAGATCAAAATCAGG - Intergenic
943548692 2:189312200-189312222 GGAAGCTGGAGAGCAAAATCCGG - Intergenic
943768929 2:191694117-191694139 GGAAGATGGAGAACAAAATATGG + Intronic
944334847 2:198520366-198520388 GGACTATGGACACCAAAAGCAGG - Intronic
944488194 2:200228864-200228886 GCAACATAATGACCAAAATCAGG - Intergenic
944855760 2:203765272-203765294 GGAAGCTGGAGAGCAAAATCTGG - Intergenic
945007902 2:205428885-205428907 GATATCTAGAGACCACAATCTGG - Intronic
945548400 2:211187506-211187528 GTGATATAGAGATAAAAATCTGG - Intergenic
945607399 2:211952152-211952174 AGAATACAGAGACCAAAATAAGG - Intronic
948016490 2:234695130-234695152 GATATGTAGAGACCACAATCTGG + Intergenic
1169584444 20:7064924-7064946 GGAATATAGAAAAAAAAAACAGG - Intergenic
1170215900 20:13890755-13890777 AGAATAAAGAAAACAAAATCTGG + Intronic
1171245888 20:23609113-23609135 TAAATATAGAGGCCTAAATCAGG + Intergenic
1172220882 20:33274166-33274188 GGACTATAGTGACCATAATAAGG - Intronic
1172345796 20:34197807-34197829 GGAATTAAGAGACCAGAGTCAGG + Intronic
1172522111 20:35574278-35574300 GGTTTTTAGAAACCAAAATCTGG + Intergenic
1172557947 20:35859347-35859369 GGAAAATAGAGATCAAAATTTGG + Intronic
1175455671 20:59111622-59111644 GATATTTAGAGACCATAATCTGG - Intergenic
1175683116 20:61005813-61005835 GCAGGACAGAGACCAAAATCAGG + Intergenic
1177083288 21:16669273-16669295 GGTATGTAGAAACCAAGATCTGG - Intergenic
1177106267 21:16959257-16959279 TGAATATAGAACCCAAAATCTGG - Intergenic
1177387413 21:20425902-20425924 GGAAGCTGGAGAGCAAAATCCGG - Intergenic
1179221993 21:39416530-39416552 GGAACTTACAGACCATAATCTGG + Intronic
1179931100 21:44571531-44571553 GGCATTTAGAAACCAAAATCTGG - Intronic
1182738749 22:32550734-32550756 GGGTTTTAGAGACCACAATCTGG - Intronic
1183658285 22:39203608-39203630 TGAATACACAGACCAAAATGTGG + Intergenic
1184448318 22:44567276-44567298 GGAAGCTGGAGAGCAAAATCTGG + Intergenic
1184491671 22:44813132-44813154 GCTATTTAGAGACCAAGATCTGG + Intronic
949184169 3:1170361-1170383 CCAATATACAGACCAAAATATGG + Intronic
950677307 3:14562164-14562186 GGAATTTAGAGTCCAGAGTCTGG - Intergenic
951033117 3:17904821-17904843 GAAAAATAGATACAAAAATCAGG - Intronic
952773754 3:37025013-37025035 GGTATTTAGAGACTATAATCTGG + Intronic
953095665 3:39773127-39773149 GGTATTTAGAAACCAAGATCTGG - Intergenic
953478148 3:43223524-43223546 GGTATTTAGAGACCACAATCTGG - Intergenic
953648672 3:44779327-44779349 GGTATTTAGAAACCAAGATCTGG + Intronic
954509883 3:51114557-51114579 GGAATATAGAGGCAGAAATGAGG + Intronic
954770614 3:52964614-52964636 GATATTTAGAGACCACAATCTGG - Intronic
955013156 3:55039738-55039760 GTTATTTAGAGACCACAATCTGG + Intronic
955550290 3:60077377-60077399 GGTATTTAGAAACCAAGATCTGG - Intronic
955857792 3:63292449-63292471 AGAATATAGTGAATAAAATCAGG - Intronic
956626852 3:71275054-71275076 GGAATAGAGAGACAAGAAACTGG - Intronic
956660239 3:71590412-71590434 GGTATTTAGAAACCAAGATCTGG - Intergenic
956771539 3:72530410-72530432 GGTATTTAGAGAGCACAATCTGG - Intergenic
956961401 3:74406394-74406416 AGAATAAATAGACCAAAATGAGG + Intronic
957619928 3:82583355-82583377 TGACTATAGACACAAAAATCTGG + Intergenic
958480593 3:94641548-94641570 TGAAAATAGACACCAAAACCAGG - Intergenic
958482787 3:94665516-94665538 GGAAAATTGACACTAAAATCTGG - Intergenic
958921910 3:100116540-100116562 GGTATTTAGAAACCAAGATCTGG + Intronic
959274710 3:104263653-104263675 GTAGTATAGAGACAAAAGTCAGG + Intergenic
959683480 3:109122131-109122153 GGAATAGAAGGGCCAAAATCAGG + Intergenic
960327183 3:116312169-116312191 GGAATAAAGAGAGGAAAATGTGG - Intronic
960648674 3:119920961-119920983 GGTATTTAGAGACCACAGTCTGG - Intronic
961217346 3:125169968-125169990 GGAAAATAGAAAGCAAAAACAGG + Intronic
962285315 3:134080931-134080953 GAGATTTAGAGACCATAATCTGG - Intronic
962658566 3:137575930-137575952 AGTATTTAGAGACCATAATCTGG - Intergenic
964483401 3:157163598-157163620 GGAGGCTAGAGAGCAAAATCCGG - Intergenic
966096000 3:176203885-176203907 GGAATCTAGAAAAGAAAATCTGG + Intergenic
966141635 3:176764002-176764024 GGTATTTAGAAATCAAAATCTGG - Intergenic
967541985 3:190679077-190679099 GCAATATCGAGACTAAAATTTGG - Intergenic
967784282 3:193473043-193473065 GGAATTTAGAAACCAAACTTTGG - Intronic
968718916 4:2184639-2184661 GGCATTTAGAGACCAGAATCTGG - Intronic
968896146 4:3404793-3404815 GAGGTATAGACACCAAAATCTGG - Intronic
970199190 4:13585265-13585287 GAAAAAAAGAGACCAAAGTCTGG + Intronic
970628077 4:17912014-17912036 AGAAGTTAGAGACCAAAATCTGG + Intronic
970702714 4:18761845-18761867 GTTATATAGGGACCAAATTCTGG + Intergenic
970795776 4:19911880-19911902 TGAAACTAGAGACTAAAATCGGG - Intergenic
971765366 4:30823950-30823972 GGAATAAAGAACCCAGAATCTGG + Intronic
972395065 4:38651850-38651872 GGAATAGAAAGACCATTATCTGG + Intergenic
972538692 4:40020556-40020578 GGAAGCTGGAGAGCAAAATCCGG + Intergenic
973929782 4:55780577-55780599 GGCATTTAGAACCCAAAATCTGG - Intergenic
975464187 4:74690883-74690905 AGAATGAAGAAACCAAAATCTGG + Intergenic
976000007 4:80363091-80363113 GAAATATACATACCAAAATATGG + Intronic
976327525 4:83789391-83789413 GGAATATAGAGAGAAAAAGTAGG - Intergenic
977395473 4:96465528-96465550 GCACTAGAGAAACCAAAATCAGG - Intergenic
977573175 4:98650703-98650725 GGAATTTAGAAGCCAAGATCTGG - Intronic
978152865 4:105457864-105457886 GGCATTTTGAAACCAAAATCTGG - Intronic
979039609 4:115772043-115772065 GGAATATAGAGACACAAATTAGG - Intergenic
980012177 4:127608906-127608928 GGTATTTAGACACCAAGATCTGG - Intergenic
980012275 4:127610025-127610047 GGTATTTAGACACCAAGATCTGG - Intergenic
981158339 4:141467019-141467041 GGCATATAGAGATCACAACCTGG - Intergenic
981248183 4:142565159-142565181 GGTATTTAGAAACCAAAGTCTGG - Intronic
981509155 4:145536296-145536318 AGTATTTAGAAACCAAAATCTGG - Intronic
982131845 4:152236163-152236185 GGCATTTAAAGACCACAATCTGG - Intergenic
982146465 4:152400120-152400142 AGAATAGAGAGACCAGAATATGG + Intronic
982827240 4:160016830-160016852 GGAAAATAGAGACAGAAATCAGG - Intergenic
982831479 4:160066522-160066544 GTAAAATTGAGACCAAAATAAGG - Intergenic
983822191 4:172209044-172209066 AGAATATAGAGAGTAGAATCAGG - Intronic
984011696 4:174379766-174379788 GGAATATATAGCCCATAATAAGG - Intergenic
986729011 5:10621278-10621300 GGTATTTAGAAACCAAAATCTGG + Intronic
987878992 5:23716921-23716943 GAAATATAGAGAACATATTCTGG - Intergenic
988029749 5:25748606-25748628 GGTATTTAGAAACCAAAATATGG - Intergenic
989314922 5:40066966-40066988 GGAAGCTGGAGAGCAAAATCCGG + Intergenic
990901288 5:60752447-60752469 GTAGTATAGAGACCAAAATGAGG - Exonic
992177692 5:74166613-74166635 GGCAGTTAGATACCAAAATCTGG + Intergenic
994404061 5:99320716-99320738 GGCAAAGAGAGAGCAAAATCTGG - Intergenic
995153088 5:108874276-108874298 GGTATAATGAGACCAAAATTAGG + Intronic
995215315 5:109588621-109588643 GGAAGCTGGAGAGCAAAATCTGG + Intergenic
997123254 5:131198220-131198242 GCAATATAATGACCAAAACCAGG + Intronic
997161928 5:131617984-131618006 TGAATTTAGAAACCAAAGTCTGG - Intronic
998489621 5:142535159-142535181 GGTATTTAGATACCAAAATCAGG - Intergenic
998824922 5:146091503-146091525 GAAATATAGAGAAAAAGATCAGG + Intronic
1002345896 5:178547380-178547402 GGACTATCAAGTCCAAAATCTGG - Intronic
1002411465 5:179081701-179081723 GGCATTTAGAAACCAAAATTTGG - Exonic
1003889102 6:10548097-10548119 GGTATTTAAAGATCAAAATCTGG + Intronic
1004187622 6:13434331-13434353 GGAATATAGAGGTCAAGTTCAGG + Intronic
1005082913 6:21974916-21974938 GGAATTTAGAAACTACAATCTGG - Intergenic
1005705192 6:28444335-28444357 GGTATATAGAAACCAAGATCTGG + Intergenic
1005761248 6:28970079-28970101 GGAAGCTGGAGAGCAAAATCCGG - Intergenic
1006526877 6:34613853-34613875 CCTATATAGAAACCAAAATCTGG - Intronic
1006540412 6:34735463-34735485 GGAATTCAGAAACCAAGATCTGG + Intergenic
1007371944 6:41431909-41431931 GGAATACACAGACCTAAAACAGG + Intergenic
1009399842 6:63241486-63241508 GGAAAATAAACCCCAAAATCAGG + Intergenic
1009646069 6:66403515-66403537 GGAATATAGCTACAAAAATATGG + Intergenic
1010162862 6:72878575-72878597 GGAATATAGAGACCAAAATCTGG + Intronic
1010572550 6:77495289-77495311 GGAGACTAGAGATCAAAATCAGG + Intergenic
1010853531 6:80808483-80808505 GGGATACAGAAACCAAAATATGG - Intergenic
1010905685 6:81485182-81485204 GAAATATAGACAGCAAACTCAGG - Intergenic
1011280208 6:85669946-85669968 GGTATTTAGAGGCCACAATCTGG + Intergenic
1011880018 6:92012489-92012511 GGAATATATACACTAAAATATGG + Intergenic
1012211976 6:96530802-96530824 GGGATTTAGAAACCAAGATCTGG + Intronic
1012769333 6:103409219-103409241 GGAATATGAAGTTCAAAATCGGG + Intergenic
1013145752 6:107389779-107389801 GGTATTTAGAAACCAATATCTGG - Intronic
1013667363 6:112362391-112362413 GGAAGCTGGAGAGCAAAATCCGG - Intergenic
1014009279 6:116458267-116458289 GGAAGCTGGAGAGCAAAATCCGG - Intergenic
1014989193 6:128053060-128053082 GGTATTTAGACACCAACATCTGG + Intronic
1015628739 6:135209162-135209184 GGTACATAGACACCAAAATCAGG + Intronic
1015644850 6:135375800-135375822 GCAATTTAGAAACTAAAATCTGG - Intronic
1015798817 6:137040404-137040426 GGTGTTTAGAAACCAAAATCTGG - Intronic
1016258613 6:142140489-142140511 GGAAAAAAGAGAACAAAAGCAGG + Intergenic
1016455621 6:144227559-144227581 GGTATTTAGAAACCAAAATCTGG + Intergenic
1016934909 6:149442337-149442359 GAAAAATAGAAACCAAAATGGGG + Intergenic
1017066208 6:150531534-150531556 AGACTATAAAGACCATAATCTGG + Intergenic
1017261309 6:152390972-152390994 GGAATATAGAGATAAAAGTTAGG - Intronic
1017582047 6:155876384-155876406 AGAATAAAAAGTCCAAAATCTGG + Intergenic
1018169025 6:161129600-161129622 GGAGTATATAGTCCATAATCAGG + Intergenic
1018185347 6:161261741-161261763 GGAATAAAGAGGGCAAAACCAGG - Intronic
1021159701 7:17257466-17257488 GGAAAATAGAGGACAAAAACAGG + Intergenic
1021620972 7:22550576-22550598 CAAAAATAGCGACCAAAATCAGG - Intronic
1022779913 7:33569928-33569950 GGTAATTAGAAACCAAAATCTGG - Intronic
1022987843 7:35676581-35676603 GGTATCTAAAGACCAAAATCTGG + Intronic
1023276428 7:38523330-38523352 GGGATTTAGAAACCAAGATCTGG - Intronic
1023288010 7:38639019-38639041 GGTATTTAGAAACCAAGATCTGG + Intergenic
1023561714 7:41480793-41480815 GGTATTTAGAAACCAAAATCTGG - Intergenic
1023896663 7:44439447-44439469 GGTATTTAGAAACCAAGATCTGG - Intronic
1024378965 7:48672406-48672428 GGGGTATAGAGACTAAAGTCTGG - Intergenic
1024781095 7:52848917-52848939 GGTATTTAGAAACCAATATCTGG + Intergenic
1024824440 7:53374521-53374543 GGCATTTAGAAACCAAAATCCGG + Intergenic
1026183726 7:68064581-68064603 AGAAAATAGAGAACAAAATCTGG + Intergenic
1026276741 7:68885537-68885559 GGCATTTAGAAACCAAAATCCGG - Intergenic
1026902874 7:74046668-74046690 GGAATAAAGAGAGCAAGTTCAGG - Intronic
1027861905 7:83594718-83594740 TAAATATACAGACTAAAATCAGG - Intronic
1027930838 7:84532878-84532900 GGAGTACATAGAACAAAATCTGG - Intergenic
1028322436 7:89476934-89476956 GGAATATATATACCACCATCTGG + Intergenic
1029165228 7:98584276-98584298 AGTATTTAGAAACCAAAATCTGG + Intergenic
1030239023 7:107299219-107299241 GAAATATTGAAACCAAAAACTGG + Intronic
1031042581 7:116854450-116854472 GGAATAAAGAGAGCAAAGCCAGG - Intronic
1031467532 7:122131729-122131751 ATTATATAGAGACCAAGATCTGG - Intronic
1031819410 7:126480854-126480876 GGTATTTAGAAATCAAAATCTGG - Intronic
1034868935 7:154665612-154665634 GGTATTTAGACACCAAGATCTGG + Intronic
1036605673 8:10303513-10303535 GTAATATGGAGACCAAAACAAGG + Intronic
1038460642 8:27713793-27713815 GGGATTTAGAAACCACAATCAGG + Intergenic
1039192138 8:34988294-34988316 GGCATTTAGAAACCAAGATCTGG + Intergenic
1041737365 8:61125455-61125477 GGAAGAGAAAGACCAAAATGAGG - Intronic
1042400242 8:68336702-68336724 GGTATTTAGAAACCAAAATGTGG - Intronic
1042500717 8:69505723-69505745 AGAATATAGAGACCTATATTTGG + Intronic
1042633042 8:70842418-70842440 GGAATTTGGAAACCAAGATCTGG + Intergenic
1043432019 8:80204451-80204473 GGTATTTAGAAACCAAGATCTGG - Intronic
1043782473 8:84353216-84353238 GGAATATAAAGATCAAATTCTGG + Intronic
1045175034 8:99713702-99713724 GGTATCTAGAAACCAAAATCTGG - Intronic
1045724161 8:105151440-105151462 GGAATATAGATACCAAAAAGAGG - Intronic
1045772110 8:105754754-105754776 GGAAAACAGAGAACAAAACCAGG + Intronic
1045965996 8:108025216-108025238 GGTATTTAGAAAACAAAATCTGG - Intronic
1046355172 8:113073814-113073836 GGAACATAGGGACTAAAATTAGG - Intronic
1046376530 8:113389370-113389392 GGAATAAAGAGAGCAAACTGAGG - Intronic
1046895929 8:119473374-119473396 GGTATTTTGAAACCAAAATCTGG - Intergenic
1046959795 8:120098758-120098780 TGAATATAGATACACAAATCAGG - Intronic
1049805945 8:144539107-144539129 GGTATTTAGAAACCAAGATCTGG + Intronic
1050567037 9:6895966-6895988 TGATTAAAGATACCAAAATCTGG - Intronic
1052106862 9:24529365-24529387 GGGATATAGTGACCAGAATGAGG + Intergenic
1052264125 9:26551928-26551950 GGAATTTAGAAACCACCATCTGG - Intergenic
1053824434 9:42006361-42006383 GGAAAATAGAGAGCAAGATAAGG + Intronic
1053857555 9:42354011-42354033 GTAATATAGCTAGCAAAATCAGG + Intergenic
1054567739 9:66776728-66776750 GTAATATAGCTAGCAAAATCAGG - Intergenic
1054606137 9:67181002-67181024 GGAAAATAGAGAGCAAGATAAGG - Intergenic
1055688600 9:78805517-78805539 GATAGTTAGAGACCAAAATCTGG + Intergenic
1055708880 9:79037360-79037382 GGAAGCTGGAGAGCAAAATCTGG - Intergenic
1055738122 9:79355276-79355298 GGGATATAGAGTCCAGCATCAGG - Intergenic
1057415998 9:94862674-94862696 GGAATCCAGAAACCAAAAACAGG - Intronic
1057876449 9:98758474-98758496 GGTATTTAGAAACCAAAATCTGG + Intronic
1057924795 9:99135795-99135817 AGAATATAGAGATCTAAATTAGG + Intronic
1058504981 9:105657637-105657659 GGAATATAGAGATAGAATTCAGG + Intergenic
1058790501 9:108439914-108439936 GGAGTTTAGAGGCCAAGATCTGG - Intergenic
1059202677 9:112432561-112432583 GGAATATAGAGGGCATTATCTGG + Intronic
1059389573 9:113990342-113990364 GGAACATGGAGACATAAATCAGG - Intronic
1060444283 9:123673564-123673586 GGTATTTAGAAACCAAGATCTGG + Intronic
1061021217 9:128016155-128016177 GGCATTTAGAAACTAAAATCTGG - Intergenic
1061600222 9:131664302-131664324 GGTATTTAGAAACCAAGATCGGG + Intronic
1187204004 X:17164862-17164884 ACAATAGAGAAACCAAAATCTGG + Intergenic
1187864333 X:23710290-23710312 GGTATTTAGACATCAAAATCTGG - Intronic
1188667008 X:32836378-32836400 GAGATATAGAAACCAAAAACGGG - Intronic
1188796087 X:34467631-34467653 GGTATTTAGAAACCAAGATCTGG - Intergenic
1188834460 X:34939584-34939606 GGTATTTAGAAACCAAGATCTGG + Intergenic
1189041687 X:37548189-37548211 GGTATTTAGAAACCAAGATCTGG - Intronic
1189448999 X:41109576-41109598 GTAATTTAGTGACAAAAATCAGG + Intronic
1189961853 X:46332029-46332051 GGTATTTAGAAACCAAGATCTGG + Intergenic
1193375851 X:80759933-80759955 GGAATCTATAGACCAAAATGTGG - Intronic
1194789895 X:98134844-98134866 GGTATTTAGAAACCAAGATCTGG - Intergenic
1194897798 X:99467592-99467614 GGCATTTAGAAACCAAGATCTGG + Intergenic
1196416000 X:115471834-115471856 GGAATATAAAGACCCATATAGGG - Intergenic
1197281395 X:124540879-124540901 GGAATATAAGGAGCAATATCAGG - Intronic
1197579903 X:128269565-128269587 GGTATTTAGGGACCAAGATCTGG - Intergenic
1199498594 X:148483765-148483787 GGAGTTTCGAGACCAAGATCTGG - Intergenic
1201862653 Y:18616225-18616247 GGAATATAGAAACCTAATTGAGG - Intergenic
1201870670 Y:18704155-18704177 GGAATATAGAAACCTAATTGAGG + Intergenic
1201928720 Y:19317921-19317943 GGAATATAGACACAAAGATGAGG - Intergenic