ID: 1010163813

View in Genome Browser
Species Human (GRCh38)
Location 6:72891834-72891856
Sequence CAAAAATCTGATAGTAATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010163809_1010163813 3 Left 1010163809 6:72891808-72891830 CCCTATCATCCATTCTCTATTTA 0: 1
1: 0
2: 3
3: 39
4: 361
Right 1010163813 6:72891834-72891856 CAAAAATCTGATAGTAATCTAGG No data
1010163811_1010163813 -6 Left 1010163811 6:72891817-72891839 CCATTCTCTATTTACCTCAAAAA 0: 1
1: 0
2: 3
3: 32
4: 483
Right 1010163813 6:72891834-72891856 CAAAAATCTGATAGTAATCTAGG No data
1010163808_1010163813 4 Left 1010163808 6:72891807-72891829 CCCCTATCATCCATTCTCTATTT 0: 1
1: 0
2: 1
3: 40
4: 404
Right 1010163813 6:72891834-72891856 CAAAAATCTGATAGTAATCTAGG No data
1010163810_1010163813 2 Left 1010163810 6:72891809-72891831 CCTATCATCCATTCTCTATTTAC 0: 1
1: 0
2: 3
3: 33
4: 343
Right 1010163813 6:72891834-72891856 CAAAAATCTGATAGTAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010163813 Original CRISPR CAAAAATCTGATAGTAATCT AGG Intronic
No off target data available for this crispr